Biocontrol Efficacy and Induced Resistance of Paenibacillus polymyxa J2-4 Against Meloidogyne incognita Infection in Cucumber

Abstract

Meloidogyne incognita is one of the most destructive agricultural pathogens around the world, resulting in severe damage to yield and quality in agricultural production. Biological control promises to be a great potential alternative to chemical agents against M. incognita. Paenibacillus polymyxa J2-4, isolated from ginger plants injured by M. incognita, has shown an excellent biocontrol efficacy against M. incognita in cucumber. In vitro experiments with the strain J2-4 resulted in a correct mortality rate of 88.79% (24 h) and 98.57% (48 h) for second-stage juveniles (J2s) of M. incognita. The strain J2-4 significantly suppressed nematode infection on potted plants, with a 65.94% reduction in galls and a 51.64% reduction in eggs compared to control. The split-root assay demonstrated that the strain J2-4 not only reduced J2s invasion but also inhibited nematode development through the dependence on salicylic acid (SA) and jasmonic acid (JA) signaling of the strain J2-4 induction of plant resistance in local and systemic roots of cucumbers. Genomic analysis of the strain J2-4 indicated biosynthetic gene clusters encoding polymyxin, fusaricidin B, paenilan and tridecaptin. In addition, genetic analysis showed that none of the genes encoding virulence factors were detected in the genome of J2-4, compared with the pathogenic Bacillus species. Taking all the data together, we conclude that P. polymyxa J2-4 has potential as a biological control agent against M. incognita on cucumbers and can be considered biologically safe when used in agriculture.

Volatile organic compounds produced by Paenibacillus polymyxaJ2‐4 exhibit toxic activity against Meloidogyne incognita

“…The isolation of strain J2‐4 was described by Shi et al 30 . For bacterial identification, the bacteria were Gram stained, and the morphological and biochemical characteristics of J2‐4 were determined according to Bergey's Manual of Determinative Bacteriology 31 .…”

“…The isolation of strain J2-4 was described by Shi et al 30 For bacterial identification, the bacteria were Gram stained, and the morphological and biochemical characteristics of J2-4 were determined according to Bergey's Manual of Determinative Bacteriology. 31 For molecular identification, the genomic DNA of J2-4 was extracted using the TIANamp Bacteria DNA Kit (Tiangen, China), and the 16S rRNA gene was amplified by PCR using the I-5™ 2× High-Fidelity Master Mix (Tsingke, China) and primers 27F (AGAGTTTGATCCTGGCTCAG)/1492R (GGTTACCTTGTTACGACTT).…”