Biodiversity of the Symbiotic Bacteria Associated with Toxic Marine Dinoflagellate Alexandrium tamarense

Abstract

Paralytic shellfish poisoning (PSP) toxins are potent neurotoxins mainly produced by dinoflagellates and being concentrated in bivalves through food web transfer. Increasing number of findings of toxin-producing bacteria in the cells of dinoflagellate such as Alexandriumtamarense supports the hypothesis of the bacterial origin of PSP toxins. Evidence that there are specific symbiosis bacterial taxa associated with the phytoplankton indicates the presence of specific selective mechanisms between them, and implies that the symbiosis bacteria have some vital function to the benefit of the dinoflagellates. Studies on the role of toxin-producing symbiosis bacteria in the marine ecosystem are considered to be becoming more important. Although toxigenic bacteria could be isolated from toxic dinoflagellates, it was not clearly proven whether the isolated bacterial strains based on culture-dependent manner and the corresponding intracellular bacteria were the same because of microbial unculturability. This paper aims to demonstrate the biodiversity of the symbiotic bacteria associated with toxic dinoflagellate A. tamarense using the culture-independent high-throughput pyrosequencing method, as well as the phylogenetic analysis based on 16S rDNA sequences of the symbiotic cultivable bacteria strains isolated from toxic Alexander tamarense.

Deciphering the associations between soil microbial diversity and ecosystem multifunctionality driven by long‐term fertilization management

“…The diversity and community structure of bacteria and fungi were assessed using high‐throughput sequencing analysis of the 16S rRNA gene within the V3–V4 hypervariable region and the 18S rRNA gene within the ITS regions. These assessments were carried out by Beijing Auwigene Tech, Ltd. (Beijing, China) using the Illumina Miseq PE300 sequencing platform (Illumina, Inc., San Diego, CA, USA) according to the manufacturer's recommendations using the universal primers 338F/806R (bacteria, ACTCCTACGGGAGGCAGCAG/GGACTACHVGGGTWT CTAAT) (Zhang et al., ) and ITS1‐F/ITS2 (fungi, CTTGGTCATTTAGAGGAAGT/TGCGTTCTT CATCGATGC) (Peters, Wu, Hayes, & Ahn, ). Raw sequences were processed using the pipeline tools QIIME (Caporaso et al., ) and MOTHUR (Schloss et al., ).…”

Current Knowledge and Recent Advances in Marine Dinoflagellate Transcriptomic Research

“…Metagenomic approaches already revealed that dinoflagellates' phycosphere is heavily colonized by bacteria [103]. Several studies have been done to investigate bacteria-dinoflagellates association especially in terms of toxin production, dinoflagellates' mortality and nutrient exchange [104][105][106].…”

Biodiversity Study of Intracellular Bacteria Closely Associated with Paralytic Shellfish Poisoning Dinoflagellates Alexandrium tamarense and A. minutum

“…There is also increasing evidence that there are specific symbiosis bacterial taxa associated with phytoplankton, indicating the presence of specific selective mechanisms, and implying that the symbiosis bacteria have some functions to the benefit of the alga, and these interactions could be the product of co-evolution between bacteria and algae over millions of years (Dantzer WR . Currently culture-independent highthroughput pyrosequencing analysis is able to provide a thorough description of microbiota community in environmental samples, which also helps to reveal their potential function (McCann JC et al 2014, Zhang XL et al 2015). This paper is aimed to demonstrate the biodiversity of the intracellular bacteria closely associated with toxic PSP-producing dinoflagellate, Alexandrium tamarense and Alexandrium minutum, using pyrosequencing method.…”