Biogenesis and function of extracellular miRNAs

Abstract

Mature microRNAs (miRNAs) are 18-24-nucleotide non-coding RNAs with post-transcriptional regulatory functions and have been documented as an essential cornerstone of the genetic system. Although the traditional idea suggests that RNA molecules cannot be stable in extracellular environments due to ubiquitous ribonuclease, miRNA has now been verified as circulating in various body fluids in a stable, cell-free form. By associating with microvesicles (MVs) or RNA-binding proteins, extracellular miRNAs can be actively secreted and transferred into recipient cells, where they regulate target genes. Importantly, extracellular miRNAs have been demonstrated as participating in various physiological and pathological processes in bodies and have significant roles in fetal-maternal crosstalk and cross-kingdom regulation. Furthermore, the abnormal expression of extracellular miRNAs has been shown to be associated with many diseases, making extracellular miRNAs promising novel noninvasive diagnostic markers. In this review, we summarize the recent literature on the biogenesis, delivery and uptake of extracellular miRNAs, elaborate on the regulating function of extracellular miRNAs between different cells and between individuals and highlight their therapeutic potential in clinical applications.

Circulating Cell-Free Nucleic Acids: Main Characteristics and Clinical Application

“…RNA molecules have also been detected in extracellular fluids ( Figure 2 ). The origin of these molecules might be passive leakage from dead cells (e.g., linked to necrosis or apoptosis), or active secretion that might occur via membrane-bound vesicles (e.g., microvesicles) or follow a vesicle-free RNA-binding protein dependent pathway (e.g., with HDL, AGO2, NPM1 proteins) [ 2 , 67 ]. The latter mechanisms are thought to be well-regulated, energy-requiring processes.…”

“…However, the biological significance of cf-RNAs is not well described yet. It is suggested that cf-RNAs might be involved in cell-to-cell communication and act as hormones [ 2 , 67 ]. These might affect tumor microenvironments contributing to tumor growth and invasion.…”

Absorbed plant MIR2911 in honeysuckle decoction inhibits SARS-CoV-2 replication and accelerates the negative conversion of infected patients

“…Subsequent studies have shown that MIR2911 also directly inhibits the replication of various viruses in addition to IAVs 3,4 . Upon dietary uptake, these microRNAs self-assemble into exosomes and are then secreted into the circulation and delivered into target tissues or specific cells, including the liver, lung, spleen, pancreas, and T cells [5][6][7] . Given the unique GC-enriched nucleotide composition of MIR2911 (GGCCGGGGGACGGACUGGGA) and after we analyzed the genome sequence of SARS-CoV-2, it is most likely that the virus genome contains MIR2911-binding sites and that MIR2911 can inhibit SARS-CoV-2 replication directly.…”

Large-scale transcriptome-wide profiling of microRNAs in human placenta and maternal plasma at early to mid gestation

“…Gestational Age (Weeks') We investigated plasma levels of the 21 miRNAs identified as both differentially and highly expressed in the matched placentas (Table 3). Whilst all 21 placental miRNAs were also detected in plasma, their origin is not necessarily placenta-specific, with cellular enrichment linked to various systemic compartments [28]. For example, five of these miRNAs have cellular enrichment in immune response, another three miRNAs in pluripotent and embryonic stem cells, and one miRNA is enriched in extra-embryonic stem cells.…”