Biological Activity of Wild Isolates of Entomopathogenic Nematodes to Horse- Chestnut Leaf Miner (Cameraria ohridella)

Abstract

One of the pests of white chestnut (Aesculus hippocastanum L.) is a horse-chestnut leaf miner (Cameraria ohridella). Effective methods of reducing the population of this butterfly are still under investigation. One of them is the use of insecticidal nematodes that occur naturally in the environment. This paper presents the results of the susceptibility of horse-chestnut leaf miner larvae on entomopathogenic nematodes of the genus Steinernema. The experiment was conducted at a temperature of 20ºC and a dose initialized to 100 nematodes/insect. Applied nematodes were harvested from the greenery of Swietokrzyskie Province. The results of the analysis showed that the larvae Cameraria ohridella are susceptible to insecticide nematode invasion isolated from different sources. It was also shown that the efficiency of killing an insect by nematodes (extensiveness of invasion) is not correlated with the ability to reproduce or the viability of successive generations of insecticidal nematodes.

Comparison of Biological Activity of Field Isolates of Steinernema feltiae with a Commercial S. feltiae Biopesticide Product

“…Genomic DNA was extracted using a Genomic Mini kit (A&A Biotechnology, Gdańsk, Poland). The internal transcribed spacer (ITS) region was amplified by PCR using forward and reverse primers SF18SL (5′GTACACACCGCCCGTCGCTGC3′) and SF18SR (5′AAATCCTAGTTAGTTTCTTTTCCTCCGC3′) [ 45 ].…”

“…Other studies have provided evidence that EPN show considerable variation in terms of biological activity, reproduction, host selection and tolerance to various environmental conditions. Thus, there is a need to gain a thorough knowledge on the natural populations of these potentially valuable organisms [ 43 , 44 , 45 ].…”

Detection of ureolytic activity of bacterial strains isolated from entomopathogenic nematodes using infrared spectroscopy

“…Every day, the dead insects were removed from boxes and the cause of their death was determined. Invasive nematode larvae were cultured in G. mellonella larvae and harvested using modified White's traps in order to obtain invasive larvae of the nematode migrating from the insect's body . The collected EPN larvae were stored in distilled water at 4 °C.…”

Impact of Abiotic and Biotic Environmental Conditions on the Development and Infectivity of Entomopathogenic Nematodes in Agricultural Soils

“…Currently, preparations based on insecticidal nematodes are directed against thrips (Thysanoptera), diptera (Diptera), beetles (Coleoptera), and butterflies (Lepidoptera). Research on the effectiveness of EPNs against various pest species has been conducted under field and laboratory conditions [ 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 ]. One of the advantages of using preparations containing these living organisms is that, following a single application, EPN populations can survive at the application site for a long time, producing new generations.…”