Bleomycin induces IL-8 and ICAM-1 expression in microvascular pulmonary endothelial cells

Fichtner, Falk; Koslowski, Roland; Augstein, Antje; Hempel, Ute; Röhlecke, Cora; Kasper, Michael

doi:10.1078/0940-2993-00345

Cited by 19 publications

(11 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Interestingly, the transcriptional level of GGGTAGCTCTCTGCCTGATG TCCGTGGTAGCAGAAGTCAA CXCL1 AGACTCCAGCCACACTCCAA TGACAGCGCAGCTCATTG CXCL2 AAAATCATCCAAAAGATAC TGAACAA CTTTGGTTCTTCCGTTGAGG CCL3 TGCCCTTGCTGTTCTTCTCT GTGGAATCTTCCGGCTGTAG CCL6 TCTTTATCCTTGTGGCTGTCC TGGAGGGTTATAGCGACGAT CCL7 TTCTGTGCCTGCTGCTCATA TTGACATAGCAGCATGTGGAT CCL9 TGGGCCCAGATCACACAT CCCATGTGAAACATTTCAATTTC C3aR GTGGCTCGCAGATCATCA AAGACTCCATGGCTCAGTCAA C5aR GCATCCGTCGCTGGTTAC TGCTGTTATCTATGGGGTCCA IL-6 GCTACCAAACTGGATATAA TCAGGA CCAGGTAGCTATGGTAC TCCAGAA OSM TGCTCCAACTCTTCCTCTCAG CAGGTTTTGGAGGCGGATA LIF AAACGGCCTGCATCTAAGG AGCAGCAGTAAGGGCACAAT Fibronectin TGGGTCTGAGTACACCGTGA GTGGAATGGAGCGCAGAG FSP-1 GGAGCTGCCTAGCTTCCTG TCCTGGAAGTCAACTTCATTGTC OPN CCCGGTGAAAGTGACTGATT TTCTTCAGAGGACACAGCATTC Definition of abbreviations: C3aR, complement 3a receptor; C5aR, complement 5a receptor; Col, collagen; FSP-1, fibroblast specific protein-1; CTGF, connective tissue growth factor; LIF, leukemia inhibitory factor; MCP-1, monocyte chemotactic protein-1; CCL2, chemokine (C-C motif) ligand 2; EMR1, EGF-like module containing, mucin-like, hormone receptor-like sequence 1; MMP12, matrix metallopeptidase-12; ICAM-1, intercellular adhesion molecule 1; OPN, osteopontin; OSM, oncostatin-M; PAI-1, plasminogen activator inhibitor-1; TGF-b, transforming growth factor-b; VCAM, vascular cell adhesion molecule 1; vWF, von Willebrand factor. intercellular adhesion molecule 1 (ICAM-1) and vascular cell adhesion molecule 1 (VCAM1) were both unchanged after BLM treatment ( Figure 3A), despite previous reports (10,12). Along with adhesion molecules, chemokines provide important signals to recruit leukocytes to sites of inflammation (24).…”

Section: Activation Of Endothelium Contributes To Inflammation and Macontrasting

confidence: 39%

“…Reports have cited changes in adhesion molecules (11,13,14), cytokines (10,11,30), vascular mediators (31), and profibrotic molecules (7,8) after the in vitro treatment of endothelial cells with BLM, but many of these mediators were not verified in vivo. Furthermore, the presence of cytokines and chemokines in bronchiolar lavage fluid and serum has been reported in patients and in animals treated with BLM, but the cellular origin of these mediators is either unknown or assumed.…”

Section: Discussionmentioning

confidence: 99%

“…The expression of adhesion molecules and chemokines at the vascular wall contribute to leukocyte homing and the extravasation of cells at sites of inflammation. Bleomycin has been shown to increase the expression of chemokines (10,11) and adhesion molecules (10,11) in endothelial cells in vitro. With the exception of a few studies (12)(13)(14), very few efforts have been undertaken to confirm the proinflammatory effects of BLM on endothelial cells in vivo.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Endothelial Cells Recruit Macrophages and Contribute to a Fibrotic Milieu in Bleomycin Lung Injury

Leach¹,

Chrobak

Han

et al. 2013

Am J Respir Cell Mol Biol

View full text Add to dashboard Cite

Section: Activation Of Endothelium Contributes To Inflammation and Macontrasting

confidence: 39%

Section: Discussionmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Endothelial Cells Recruit Macrophages and Contribute to a Fibrotic Milieu in Bleomycin Lung Injury

Leach¹,

Chrobak

Han

et al. 2013

Am J Respir Cell Mol Biol

View full text Add to dashboard Cite

“…Increased plasma concentrations of IL-8 and S100A12, both related to neutrophil recruitment and activation, were also associated with significantly worse outcomes in IPF. IL-8, a potent inflammatory chemokine that signals neutrophils to sites of injury (59), has been previously suggested as a regulator in IPF. Carré and coworkers (60) found elevated levels of IL-8 mRNA in alveolar macrophages and elevated levels of IL-8 protein in the bronchoalveolar lavage from patients with IPF compared with normal subjects.…”

Section: Discussionmentioning

confidence: 99%

Peripheral Blood Proteins Predict Mortality in Idiopathic Pulmonary Fibrosis

Richards

Kaminski

Baribaud³

et al. 2012

Am J Respir Crit Care Med

335

287

View full text Add to dashboard Cite

Rationale: Idiopathic pulmonary fibrosis (IPF) is a lethal lung disease of unknown etiology with a variable and unpredictable course. Objectives: The aim of this study was to identify and validate plasma proteins that are predictive of outcome in IPF. Methods: Plasma samples were available for 241 patients with IPF (140 derivation and 101 validation). In the derivation cohort, concentrations of 92 proteins were analyzed using a multiplex beadbased immunoassay and concentrations of matrix metalloproteinase (MMP)-7, MMP-1, and surfactant protein D were assessed by ELISA. In the validation cohort concentrations of intercellular adhesion molecule (ICAM)-1, IL-8, and vascular cell adhesion molecule (VCAM)-1 were assessed by bead-based multiplex assay, and S100A12 and MMP-7 by ELISA. Associations of biomarkers with mortality, transplant-free survival, and disease progression were tested in the derivation and validation cohorts using nonparametric methods of survival analysis and the Cox proportional hazards model, and an integrated risk prediction score was derived and tested. Measurements and Main Results: High concentrations of MMP-7, ICAM-1, IL-8, VCAM-1, and S100A12 predicted poor overall survival, poor transplant-free survival, and poor progression-free survival in the derivation cohort. In the independent validation cohort high concentrations of all five were predictive of poor transplant-free survival; MMP-7, ICAM-1, and IL-8 of overall survival; and ICAM-1 of poor progression-free survival. The personal clinical and molecular mortality prediction index derived in the derivation cohort was highly predictive of mortality in the validation cohort. Conclusions: Our results suggest that plasma proteins should be evaluated as a tool for prognosis determination in prioritization of patients for lung transplantation and stratification in drug studies.

show abstract

“…In the present study, we found increased expression of ICAM-1 on the surface of endothelial cells in vitro after exposure to bleomycin and cisplatin. Up-regulation of ICAM-1 was also demonstrated in a rat model of bleomycininduced pulmonary fibrosis (41) and in primary human pulmonary micro-vascular endothelial cells (HMVEC-L) after exposure to bleomycine (42). Cisplatin up-regulated ICAM-1 in human umbilical vein endothelial cells (HUVECs) (43) and in a rat model of cisplatin-induced nephrotoxicity renal ICAM-1 mRNA levels were increased after exposure to this drug, while monoclonal anti-ICAM antibodies protected from renal dysfunction following cisplatin administration (44).…”

Section: ------------------------------------------------------------mentioning

confidence: 96%

Vascular damage in testicular cancer patients: A study on endothelial activation by bleomycin and cisplatin in vitro

Meijer¹

2009

Oncol Rep

View full text Add to dashboard Cite

Abstract. Following treatment with bleomycin-and cisplatincontaining chemotherapy, testicular cancer patients frequently develop vascular complications, which may result from damage to endothelial cells. Understanding bleomycin-and cisplatininduced endothelial alterations may help to develop strategies to prevent or reduce vascular toxicity. The effects of bleomycin and cisplatin on proliferation and apoptosis of the human dermal microvascular endothelial cell line HMEC-1 were determined. In addition, modulation of drug-induced cytotoxicity by the free radical scavenger amifostine, the low molecular weight heparin dalteparin, the iron-chelator dexrazoxane, the HMG-CoA reductase inhibitor rosuvastatin and the PPAR agonist troglitazone was tested. Furthermore, the effects of bleomycin and cisplatin on endothelial activation measured by the expression of the intercellular adhesion molecule-1 (ICAM-1) and on two main proteins involved in fibrinolysis, tissue-type plasminogen activator (tPA) and plasminogen activator inhibitor type 1 (PAI-1), were measured. Decreased endothelial cell survival induced by bleomycin and cisplatin coincided with the induction of apoptosis. Only troglitazone was able to protect the endothelial cells from both bleomycin-and cisplatin-induced cytotoxicity. At high concentrations, amifostine and dexrazoxane also protected HMEC-1 from drug-induced cytotoxicity. However, due to the required high (toxic) concentrations of both modulators no absolute cell survival benefit could be achieved. Both bleomycin and cisplatin induced up-regulation of ICAM-1, tPA and PAI-1. Summarizing, bleomycin and cisplatin induce alterations in the function of endothelial cells regarding proliferation, inflammation and fibrinolysis in vitro. Strategies aimed at these functions should be developed in order to ameliorate or prevent cytostatic agent-induced vascular damage.

show abstract

Bleomycin induces IL-8 and ICAM-1 expression in microvascular pulmonary endothelial cells

Cited by 19 publications

References 28 publications

Endothelial Cells Recruit Macrophages and Contribute to a Fibrotic Milieu in Bleomycin Lung Injury

Endothelial Cells Recruit Macrophages and Contribute to a Fibrotic Milieu in Bleomycin Lung Injury

Peripheral Blood Proteins Predict Mortality in Idiopathic Pulmonary Fibrosis

Vascular damage in testicular cancer patients: A study on endothelial activation by bleomycin and cisplatin in vitro

Contact Info

Product

Resources

About