BMPER Ameliorates Renal Fibrosis by Inhibiting Tubular Dedifferentiation and Fibroblast Activation

Abstract

Tubulointerstitial fibrosis is both a pathological manifestation of chronic kidney disease and a driving force for the progression of kidney disease. A previous study has shown that bone morphogenetic protein-binding endothelial cell precursor-derived regulator (BMPER) is involved in lung fibrogenesis. However, the role of BMPER in renal fibrosis remains unknown. In the present study, the expression of BMPER was examined by real-time PCR, Western blot and immunohistochemical staining. The in vitro effects of BMPER on tubular dedifferentiation and fibroblast activation were analyzed in cultured HK-2 and NRK-49F cells. The in vivo effects of BMPER were dissected in unilateral ureteral obstruction (UUO) mice by delivery of BMPER gene via systemic administration of plasmid vector. We reported that the expression of BMPER decreased in the kidneys of UUO mice and HK-2 cells. TGF-β1 increased inhibitor of differentiation-1 (Id-1) and induced epithelial mesenchymal transition in HK-2 cells, and knockdown of BMPER aggravated Id-1 up-regulation, E-cadherin loss, and tubular dedifferentiation. On the contrary, exogenous BMPER inhibited Id-1 up-regulation, prevented E-cadherin loss and tubular dedifferentiation after TGF-β1 exposure. In addition, exogenous BMPER suppressed fibroblast activation by hindering Erk1/2 phosphorylation. Knockdown of low-density lipoprotein receptor-related protein 1 abolished the inhibitory effect of BMPER on Erk1/2 phosphorylation and fibroblast activation. Moreover, delivery of BMPER gene improved renal tubular damage and interstitial fibrosis in UUO mice. Therefore, BMPER inhibits TGF-β1-induced tubular dedifferentiation and fibroblast activation and may hold therapeutic potential for tubulointerstitial fibrosis.

Isoliquiritigenin ameliorates advanced glycation end‐products toxicity on renal proximal tubular epithelial cells

“…TGF‐β1‐ stimulated HK‐2 cells has been shown to exhibit increased α‐SMA levels and reduced E‐cadherin levels during mesenchymal transition in HK‐2 cells 17,18 . Our results show that AGE‐induced TGF‐β1 and α‐SMA levels in HK‐2 cells indicating mesenchymal transition.…”

“…TGF-β1-stimulated HK-2 cells has been shown to exhibit increased α-SMA levels and reduced E-cadherin levels during mesenchymal transition in HK-2 cells. 17,18 Our results show that AGEinduced TGF-β1 and α-SMA levels in HK-2 cells indicating mesenchymal transition. However, treatment with 100, 150, and 200 nM of isoliquiritigenin effectively inhibited such events of renal fibrosis.…”

NAD(P)H: quinone oxidoreductase 1 attenuates oxidative stress and apoptosis by regulating Sirt1 in diabetic nephropathy

“…Using TRIzol reagent (Invitrogen), total RNA was extracted from kidney tissues or HK-2 cells, and cDNA was prepared using a reverse transcription kit (Promega, Madison, WI, USA) according to the instructions. Real-time PCR was performed using SYBR Premix Ex Taq II on an Agilent Mx3000P qPCR System (Agilent, CA), and GAPDH served as an internal control [ 27 , 28 ]. The primers used were as follows: NQO1 (human), F: ATGTATGACAAAGGACCCTTCC and R: TCCCTTGCAGAGAGTACATGG; Sirt1 (human), F: CAGTGTCATGGTTCCTTTGC and R: CACCGAGGAACTACCTGAT; GAPDH (human), F: CTGACTTCAACAGCGACACC and R: TGCTGTAGCCAAATTCGTTGT; NQO1 (mouse), F: AGGATGGGAGGTACTCGAATC and R: TGCTAGAGATGACTCGGAAGG; Sirt1 (mouse), F: TCAGAGTTGCCACCAACAC and R: TACTGGAACCAACAGCCTTA; and GAPDH (mouse), F: CGGAGTCAACGGATTTGGTCGTAT and R: AGCCTTCTCCATGGTGGTGAAGAC.…”