Botanical microbiomes on the cheap: Inexpensive molecular fingerprinting methods to study plant‐associated communities of bacteria and fungi

Abstract

High‐throughput sequencing technologies have revolutionized the study of plant‐associated microbial populations, but they are relatively expensive. Molecular fingerprinting techniques are more affordable, yet yield considerably less information about the microbial community. Does this mean they are no longer useful for plant microbiome research? In this paper, we review the past 10 years of studies on plant‐associated microbiomes using molecular fingerprinting methodologies, including single‐strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), amplicon length heterogeneity PCR (LH‐PCR), ribosomal intergenic spacer analysis (RISA) and automated ribosomal intergenic spacer analysis (ARISA), and terminal restriction fragment length polymorphism (TRFLP). We also present data juxtaposing results from TRFLP methods with those generated using Illumina sequencing in the comparison of rhizobacterial populations of Brazilian maize and fungal surveys in Canadian tomato roots. In both cases, the TRFLP approach yielded the desired results at a level of resolution comparable to that of the MiSeq method, but at a fraction of the cost. Community fingerprinting methods (especially TRFLP) remain relevant for the identification of dominant microbes in a population, the observation of shifts in plant microbiome community diversity, and for screening samples before their use in more sensitive and expensive approaches.

The plant endosphere world – bacterial life within plants

“…Therefore, more traditional methods, such as isolation, culture and fingerprinting, have been maintained and are becoming popular again. For instance, traditional fingerprinting methods, such as terminal restriction fragment length polymorphism (T‐RLFP), can yield results comparable to recent metabarcoding approaches regarding the structure of plant bacterial endophytic communities, but their cost is much lower, making them accessible to a larger scientific community (Johnston‐Monje and Mejia, 2020). Compared to second‐generation metabarcoding approaches, isolation and culture of bacterial endophytes permit more accurate taxonomic identification through the sequencing of longer portions of marker genes (Asghari et al ., 2019) or whole‐genome sequencing (WGS) (López‐Fernández et al ., 2015; Chaudhry et al ., 2017; Jauri et al ., 2019; Eida et al ., 2020).…”

Effects of maternal genotypic identity and genetic diversity of the red mangroveRhizophora mangleon associated soil bacterial communities: A field‐based experiment

“…The T‐RFLP community fingerprinting method was used to compare soil bacterial community composition and taxa richness between the plots. While T‐RFLP cannot provide taxonomic identification of the bacterial community, it is an established molecular tool which can yield results at a level of resolution comparable to metabarcode sequencing with Illumina Miseq when studying community shifts in plant‐associated microbiomes (Johnston‐Monje & Lopez Mejia, 2020). The 16S rRNA gene was amplified in the soil DNA samples using primers 63F (5′‐CAGGCCTAACACATGCAAGTC‐3) labelled with 6‐FAM fluorescent dye at the 5′end and 530R (5′‐GTATTACCGCGGCTGCTG‐3′) as per Thomson et al.…”

Experimental and computational approaches to unravel microbial community assembly

“…These methods present very low resolution when compared to 16S amplicon sequencing, but may represent a convenient way to analyze the overall community stability of complex communities, and will likely be able to provide a semi-quantitative assessment of the relative abundance of known members of simple communities. Overall, these methods have shown a comparable capacity to discern broad scale diversity patterns when compared to high-throughput sequencing methods, but seem to systematically underestimate community richness [19] , [20] , [21] , [22] .…”