Both UDP N-acetylglucosamine pyrophosphorylases of Tribolium castaneum are critical for molting, survival and fecundity

Arakane, Yasuyuki; Baguinon, Marilyn C.; Jasrapuria, Sinu; Chaudhari, Sujata S.; Doyungan, Alison; Kramer, Karl J.; Muthukrishnan, Subbaratnam; Beeman, Richard W.

doi:10.1016/j.ibmb.2010.09.011

Cited by 73 publications

(65 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…4b). The abnormal pupal and adult phenotypes were consistent with Arakane’s findings that abnormal iii larvae and adults emerged after RNAi targeting CHS1a , and vi adults emerged after RNAi targeting CHS1b or other genes [9, 61, 62]. …”

Section: Discussionsupporting

confidence: 86%

Knockdown of five trehalase genes using RNA interference regulates the gene expression of the chitin biosynthesis pathway in Tribolium castaneum

et al. 2016

View full text Add to dashboard Cite

BackgroundRNA interference is a very effective approach for studies on gene function and may be an efficient method for controlling pests. Trehalase is a key gene in the chitin biosynthesis pathway in insects. Five trehalase genes have been cloned in Tribolium castaneum, though it is not known whether the detailed functions of these trehalases can be targeted for pest control.ResultsThe functions of all five trehalase genes were studied using RNAi, and the most important results showed that the expression of all 12 genes decreased significantly from 12 to 72 h compared with the control groups, except GP1 at 72 h, when the expression of the TcTre2 gene was suppressed. The results also revealed different abnormal phenotypes, and the observed mortality rates ranged from 17 to 42 %. The qRT-PCR results showed that the expression of TPS, GS, two GP, CHS1a and CHS1b genes decreased significantly, while that of the CHS2 gene decreased or increased after RNAi after the five trehalases were silenced at 48 h. In addition, TPS gene expression decreased from 12 to 72 h after dsTcTre injection.ConclusionsThese results demonstrate that silencing of any individual trehalase gene, especially Tre1-4 and Tre2 gene can lead to moulting deformities and a high mortality rate through the regulation of gene expression in the chitin biosynthesis pathway and may be a potential approach for pest control in the future.Electronic supplementary materialThe online version of this article (doi:10.1186/s12896-016-0297-2) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionsupporting

confidence: 86%

Knockdown of five trehalase genes using RNA interference regulates the gene expression of the chitin biosynthesis pathway in Tribolium castaneum

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Interestingly, UDP-GlcNAc pyrophosphorylase I (TcUAP1) was increased more than 5-fold in DFB treated larvae. There are two genes encoding UDP-GlcNAc pyrophosphorylases in T. castaneum , but only TcUAP1 has been shown to be required for chitin synthesis in the cuticle and PM (Arakane et al, 2011). As the TcUAP1 gene expression level is unaltered following DFB treatment, increased protein levels in the midgut appear rather to be due to increased translation or to a decrease in the turnover of this protein.…”

Section: Discussionmentioning

confidence: 99%

Genomic and proteomic studies on the effects of the insect growth regulator diflubenzuron in the model beetle species Tribolium castaneum

Merzendorfer

Kim

Chaudhari

et al. 2012

Insect Biochemistry and Molecular Biology

Self Cite

View full text Add to dashboard Cite

SUMMARY Several benzoylphenyl urea-derived insecticides such as diflubenzuron (DFB, Dimilin®) are in wide use to control various insect pests. Although this class of compounds is known to disrupt molting and to affect chitin content, their precise mode of action is still not understood. To gain a broader insight into the mechanism underlying the insecticidal effects of benzoylphenyl urea compounds, we conducted a comprehensive study with the model beetle species and stored product pest Tribolium castaneum (red flour beetle) utilizing genomic and proteomic approaches. DFB was added to a wheat flour-based diet at various concentrations and fed to larvae and adults. We observed abortive molting, hatching defects and reduced chitin amounts in the larval cuticle, the peritrophic matrix and eggs. Electron microscopic examination of the larval cuticle revealed major structural changes and a loss of lamellate structure of the procuticle. We used a genomic tiling array for determining relative expression levels of about 11,000 genes predicted by the GLEAN algorithm. About 6% of all predicted genes were more than 2-fold up-or down-regulated in response to DFB treatment. Genes encoding enzymes involved in chitin metabolism were unexpectedly unaffected, but many genes encoding cuticle proteins were affected. In addition, several genes presumably involved in detoxification pathways were up-regulated. Comparative 2D gel electrophoresis of proteins extracted from the midgut revealed 388 protein spots, of which 7% were significantly affected in their levels by DFB treatment as determined by laser densitometry. Mass spectrometric identification revealed that UDP-N-acetylglucosamine pyrophosphorylase and glutathione synthetase were up-regulated. In summary, the red flour beetle turned out to be a good model organism for investigating the global effects of bioactive materials such as insect growth regulators and other insecticides. The results of this study recapitulate all of the different DFB-induced symptoms in a single model insect, which have been previously found in several different insect species, and further illustrate that DFB-treatment causes a wide range of effects at the molecular level.

show abstract

“…These cDNA templates and the pair of TcRtv -specific primers, forward primer 5′-ATGGGTCTGTTTAGATCAATTT-3′ and reverse primer 5′- TTACAAAAATCGTAAAATCAGTCT -3′, were used for RT-PCR to determine the TcRtv expression profile. The T. castaneum ribosomal protein-6 ( TcRpS6 ) gene was used as an internal control for equal loading of cDNA templates [22].…”

Section: Methodsmentioning

confidence: 99%

Retroactive Maintains Cuticle Integrity by Promoting the Trafficking of Knickkopf into the Procuticle of Tribolium castaneum

et al. 2013

Self Cite

View full text Add to dashboard Cite

Molting, or the replacement of the old exoskeleton with a new cuticle, is a complex developmental process that all insects must undergo to allow unhindered growth and development. Prior to each molt, the developing new cuticle must resist the actions of potent chitinolytic enzymes that degrade the overlying old cuticle. We recently disproved the classical dogma that a physical barrier prevents chitinases from accessing the new cuticle and showed that the chitin-binding protein Knickkopf (Knk) protects the new cuticle from degradation. Here we demonstrate that, in Tribolium castaneum, the protein Retroactive (TcRtv) is an essential mediator of this protective effect of Knk. TcRtv localizes within epidermal cells and specifically confers protection to the new cuticle against chitinases by facilitating the trafficking of TcKnk into the procuticle. Down-regulation of TcRtv resulted in entrapment of TcKnk within the epidermal cells and caused molting defects and lethality in all stages of insect growth, consistent with the loss of TcKnk function. Given the ubiquity of Rtv and Knk orthologs in arthropods, we propose that this mechanism of new cuticle protection is conserved throughout the phylum.

show abstract

Both UDP N-acetylglucosamine pyrophosphorylases of Tribolium castaneum are critical for molting, survival and fecundity

Cited by 73 publications

References 24 publications

Knockdown of five trehalase genes using RNA interference regulates the gene expression of the chitin biosynthesis pathway in Tribolium castaneum

Knockdown of five trehalase genes using RNA interference regulates the gene expression of the chitin biosynthesis pathway in Tribolium castaneum

Genomic and proteomic studies on the effects of the insect growth regulator diflubenzuron in the model beetle species Tribolium castaneum

Retroactive Maintains Cuticle Integrity by Promoting the Trafficking of Knickkopf into the Procuticle of Tribolium castaneum

Contact Info

Product

Resources

About