Bringing Laboulbeniales into the 21st century: enhanced techniques for extraction and PCR amplification of DNA from minute ectoparasitic fungi

Abstract

Laboulbeniales is one of the most peculiar orders of Ascomycota. These fungi are characterized by an ectoparasitic life-style on arthropods, determinate growth, lack of an asexual stage, high species richness, and intractability to culture. The order Laboulbeniales, sister to Pyxidiophorales, has only recently been assigned a separate class, the Laboulbeniomycetes, based on very few ribosomal DNA sequences. So far, DNA isolations and PCR amplifications have proven difficult. Here, we provide details of isolation techniques and the application of commercially available kits that enable efficient and reliable genetic analyses of these fungi. We provide 43 newly generated Laboulbeniales ribosomal DNA sequences, among which are the first published sequences for species in the genera Gloeandromyces, Herpomyces, Laboulbenia, Monoicomyces, and Polyandromyces. DNA extractions were possible using from 1 to 30 thalli from hosts preserved in ethanol (70–100 %). In two cases, we successfully isolated DNA from thalli on dried insect collections. Laboulbeniales molecular systematics could be substantially enhanced through these improved methods by allowing more complete sampling of both taxa and gene regions.

Laboulbeniales hyperparasites (Fungi, Ascomycota) of bat flies: Independent origins and host associations

“…DNA was extracted from 1–14 Laboulbeniales thalli using the Extract‐N‐Amp Plant PCR Kit (Sigma‐Aldrich, St. Louis, Missouri) (Haelewaters et al., ) or the REPLI‐g Single Cell Kit (Qiagen, Valencia, California) (Haelewaters et al., in review). Pretreatments employed with the Extract‐N‐Amp method included a prolonged incubation period at 56°C in 20 μl Extraction Solution up to 24‐hr in a Shake ‘N Bake Hybridization Oven (Boekel Scientific model #136400‐2, Feasterville, Pennsylvania) and mechanically crushing fungal material in a FastPrep FP120 Cell Disrupter (Thermo Fisher Scientific, Waltham, Massachusetts) at 5.5 m/s for 20 s. For about two thirds of our extractions, and as a rule for later extractions, thalli were manually cut in 2 or 3 parts (usually through the perithecium) using a #10 surgical blade on disposable Bard‐Parker handle (Aspen Surgical, Caledonia, Michigan) to ensure successful lysis.…”

“…The nuclear small and large ribosomal subunits of the ribosomal DNA (SSU and LSU rDNA) were amplified. Primer pairs for SSU were NSL1 (5′‐GTAGTGTCCTCrCATGCTTTTGAC‐3′) and NSL2 (5′‐AATCyAAGAATTTCACCTCTGAC‐3′) or NSL1 and R (5′‐TGATCCTTCTGCAGGTTCACCTACG‐3′) (Haelewaters et al., ; Wrzosek, ). Primer pairs for LSU were LR0R (5′‐ACCCGCTGAACTTAAGC‐3′) and LR5 (5′‐ATCCTGAGGGAAACTTC‐3′) or LIC24R (5′‐GAAACCAACAGGGATTG‐3′) and LR3 (5′‐GGTCCGTGTTTCAAGAC‐3′) (Miadlikowska & Lutzoni, , Vilgalys & Hester, ; R. Vilgalys, unpublished data).…”

A crush on small fungi: An efficient and quick method for obtainingDNAfrom minute ascomycetes

“…A variety of methods have been proposed to extract DNA for PCR from thalli of Laboulbeniales (Blackwell & Jones, ; Haelewaters, ; Haelewaters et al., ; Weir & Blackwell, ,b). Direct PCR without any mechanical or chemical disruption is mostly unsuccessful (Haelewaters, ), as are boiling, microwave treatment, and immersion in liquid nitrogen (Weir & Blackwell, 2001a).…”

“…Haelewaters et al. () took another approach and evaluated a number of DNA extraction protocols, both readily available commercial kits and custom protocols, targeting several genera of Laboulbeniales. Although the best among these protocols had a relatively high PCR success rate (65%), extraction and amplification from single thalli were only occasionally successful.…”

“…Once detached, thalli are often haphazardly lost due to static electricity, especially when air humidity is low. Including part of the host in the DNA extraction has been attempted as a simplification (Haelewaters et al., ). However, the extract will then contain DNA from the host and possibly other, unwanted fungi present in the host tissue.…”