Burn Injury Alters the Intestinal Microbiome and Increases Gut Permeability and Bacterial Translocation

Earley, Zachary M.; Akhtar, Suhail; Green, Stefan J.; Naqib, Ankur; Khan, Omair; Cannon, Abigail R.; Hammer, Adam M.; Morris, Niya L.; Li, Xiaoling; Eberhardt, Joshua; Gamelli, Richard L.; Kennedy, Richard H.; Choudhry, Mashkoor A.

doi:10.1371/journal.pone.0129996

Cited by 223 publications

(197 citation statements)

References 54 publications

Supporting

Mentioning

177

Contrasting

Unclassified

Order By: Relevance

“…Damage to this barrier makes the environment less hypoxic, conducive to aerobic bacterial growth [39,48]. Microbial-derived butyrate stabilizes gut epithelial tight junction proteins, depletes oxygen, and activates/stabilizes HIF-1 in epithelial cells [49,50].…”

Section: Resultsmentioning

confidence: 99%

Imbalance of gut microbiome and intestinal epithelial barrier dysfunction in patients with high blood pressure

et al. 2018

View full text Add to dashboard Cite

Recent evidence indicates a link between gut pathology and microbiome with hypertension (HTN) in animal models. However, whether this association exists in humans is unknown. Thus, our objectives in the present study were to test the hypotheses that high blood pressure (BP) patients have distinct gut microbiomes and that gut–epithelial barrier function markers and microbiome composition could predict systolic BP (SBP). Fecal samples, analyzed by shotgun metagenomics, displayed taxonomic and functional changes, including altered butyrate production between patients with high BP and reference subjects. Significant increases in plasma of intestinal fatty acid binding protein (I-FABP), lipopolysaccharide (LPS), and augmented gut-targetting proinflammatory T helper 17 (Th17) cells in high BP patients demonstrated increased intestinal inflammation and permeability. Zonulin, a gut epithelial tight junction protein regulator, was markedly elevated, further supporting gut barrier dysfunction in high BP. Zonulin strongly correlated with SBP (R2 = 0.5301, P<0.0001). Two models predicting SBP were built using stepwise linear regression analysis of microbiome data and circulating markers of gut health, and validated in a separate cohort by prediction of SBP from zonulin in plasma (R2 = 0.4608, P<0.0001). The mouse model of HTN, chronic angiotensin II (Ang II) infusion, was used to confirm the effects of butyrate and gut barrier function on the cardiovascular system and BP. These results support our conclusion that intestinal barrier dysfunction and microbiome function are linked to HTN in humans. They suggest that manipulation of gut microbiome and its barrier functions could be the new therapeutic and diagnostic avenues for HTN.

show abstract

Section: Resultsmentioning

confidence: 99%

Imbalance of gut microbiome and intestinal epithelial barrier dysfunction in patients with high blood pressure

et al. 2018

View full text Add to dashboard Cite

show abstract

“…We have shown that ethanol intoxication exacerbates the suppression of intestinal T cells and potentiates small bowel barrier disruption, and increases Gram-negative bacterial overgrowth within one day after burn injury (8, 9). More recently, we have discovered changes to the microbiome in our rodent model of burn injury directly reflect the changes observed to the microbiome of hospitalized burn patients (10). Microbial dysbiosis and gut leakiness may represent significant confounding factors to post-burn pathogenesis.…”

Section: Introductionmentioning

confidence: 88%

“…Slides were deparaffinized, dried for 25 minutes at 50°C, and then incubated with the indicated probes at a final concentration of 1ng/μl in hybridization buffer (0.9M NaCl, 20mMTris-HCL, pH 7.5, 0.1% SDS) overnight at 50°C in a humidified slide box. Probe sequences were as follows(10): Universal bacterial probe EUB338: Alexa 555 5′-GCTGCCTCCCGTAGGAGT -3′…”

Section: Methodsmentioning

confidence: 99%

Interleukin-22 Prevents Microbial Dysbiosis and Promotes Intestinal Barrier Regeneration Following Acute Injury

Hammer

Morris

Cannon

et al. 2017

Shock

Self Cite

View full text Add to dashboard Cite

Intestine barrier disruption and bacterial translocation can contribute to sepsis and multiple organ failure- leading causes of mortality in burn-injured patients. Additionally, findings suggest ethanol (alcohol) intoxication at the time of injury worsens symptoms associated with burn injury. We have previously shown that interleukin-22 (IL-22) protects from intestinal leakiness and prevents overgrowth of Gram-negative bacteria following ethanol and burn injury, but how IL-22 mediates these effects has not been established. Here, utilizing a model of ethanol and burn injury, we show that the combined insult results in a significant loss of proliferating cells within small intestine crypts and increases Enterobacteriaceae copies, despite elevated levels of the anti-microbial peptide (AMPs) lipocalin-2. IL-22 administration restored numbers of proliferating cells within crypts, significantly increased Reg3β, Reg3γ, lipocalin-2 AMP transcript levels in intestine epithelial cells, and resulted in complete reduction of Enterobacteriaceae in the small intestine. Knockout of signal transducer and activator of transcription factor-3 (STAT3) in intestine epithelial cells resulted in complete loss of IL-22 protection, demonstrating STAT3 is required for intestine barrier protection following ethanol combined with injury. Together, these findings suggest IL-22/STAT3 signaling is critical to gut barrier integrity and targeting this pathway may be of beneficial clinical relevance following burn injury.

show abstract

“…Real-time PCR analysis using specific primer sets targeting small subunit (SSU) 16s rRNA of total bacteria and Enterobacteriaceae were used to quantify the fecal microbiome as described previously (26). Primer sequences were: 340F (ACTCCTACGGGAGGCAGCAGT) and 514R (ATTACCGCGGCTGCTGGC) for total bacteria, and 515F (GTGCCAGCAGCCGCGGTAA) 826R (GCCTCAAGGGCACAACCTCCAAG) for Enterobacteriaceae (Invitrogen).…”

Section: Methodsmentioning

confidence: 99%

The Effects of Alcohol Intoxication and Burn Injury on the Expression of Claudins and Mucins in the Small and Large Intestines

Hammer

Khan

Morris

et al. 2016

Shock

Self Cite

View full text Add to dashboard Cite

Alcohol intoxication at the time of burn injury exacerbates post-burn pathogenesis. Recent findings suggest gut barrier integrity is compromised after combined alcohol and burn insult, which could contribute to these complications. Tight junction proteins and mucins play critical roles in keeping the gut barrier intact. Therefore, the goal of this study was to examine the effects of alcohol and burn injury on claudin and mucin expression in the intestines. We also evaluated if the combined insult differentially influences their expression in the small and large intestines. Male C57BL/6 mice were given a single dose of 2.9g/kg ethanol prior to a ~12.5% body area burn. One and three days following injury, we profiled expression of several tight junction proteins, mucin, and bacterial 16S rRNA genes in small and large intestine using qPCR. We observed >50% decrease in claudin-4 and claudin-8 genes in both ileal and colonic epithelial cells one day after injury. Claudin-2 was significantly upregulated, and occludin was down-regulated in small intestine one day following injury. Mucin-3 expression was substantially elevated (>50%) in small intestine, whereas mucin-2, and mucin-4 were considerably diminished in the colon (>50%) one day following injury. Most parameters were normalized to sham levels on day three, except for mucin-3 and claudin-8, which remained decreased in large intestine. Neither alcohol nor burn alone resulted in changes in junction or mucin gene expression compared to shams. This was accompanied with increases in the family of Gram-negative bacteria, Enterobacteriaceae, in both small and large intestine one day following injury. These findings suggest that alcohol and burn injury disrupts normal gut microbiota and alters tight junction and mucin expression in the small and large intestines.

show abstract

Burn Injury Alters the Intestinal Microbiome and Increases Gut Permeability and Bacterial Translocation

Cited by 223 publications

References 54 publications

Imbalance of gut microbiome and intestinal epithelial barrier dysfunction in patients with high blood pressure

Imbalance of gut microbiome and intestinal epithelial barrier dysfunction in patients with high blood pressure

Interleukin-22 Prevents Microbial Dysbiosis and Promotes Intestinal Barrier Regeneration Following Acute Injury

The Effects of Alcohol Intoxication and Burn Injury on the Expression of Claudins and Mucins in the Small and Large Intestines

Contact Info

Product

Resources

About