‘Candidatus Branchiomonas cysticola’ is a common agent of epitheliocysts in seawater-farmed Atlantic salmon Salmo salar in Norway and Ireland

Abstract

The prevalence and geographical distribution of the recently described endosymbiont 'Candidatus Branchiomonas cysticola' in Atlantic salmon Salmo salar gill epithelial cell cysts was investigated in seawater-farmed fish suffering proliferative gill inflammation (PGI). To this end, we developed a specific and sensitive real-time PCR assay for detection of the bacterium. 'Ca. B. cysticola' was found to be highly prevalent in Atlantic salmon gills sampled over 7 yr and from 17 geographically distant seawater locations in Norway and Ireland. 'Ca. B. cysticola' was found in significantly greater quantities in fish with large numbers of epitheliocysts, and fluorescence in situ hybridization confirmed its localisation within cysts. 'Ca. Piscichlamydia salmonis', a bacterium previously linked to epitheliocysts, was identified at relatively low levels of infection, apparently independent of epitheliocyst prevalence. These results suggest that 'Ca. B. cysticola' is the main cyst-forming bacterium in seawater-farmed Atlantic salmon in the studied countries. Our results also suggest a relationship between load of 'Ca. B. cysticola' and extent of pathological changes. Taken together with a previously described association between epitheliocyst load and severity of PGI in Norwegian salmon, the results could indicate a role for 'Ca. B. cysticola' in gill diseases such as PGI.

Capture severity, infectious disease processes and sex influence post-release mortality of sockeye salmon bycatch

“…(2013)R—GCTACTTCACCCTGATTGGP—ACATCAGCAGGCTTCAGAGTCACTGre_sal Renibacterium salmoninarum Bacterium00F—CAACAGGGTGGTTATTCTGCTTTC0.93Powell et al . (2005)R—CTATAAGAGCCACCAGCTGCAAP—CTCCAGCGCCGCAGGAGGACc_b_cys Candidatus Branchiomonas cysticola Bacterium96100F—AATACATCGGAACGTGTCTAGTG0.90Mitchell et al . (2013)R—GCCATCAGCCGCTCATGTGP—CTCGGTCCCAGGCTTTCCTCTCCCAye_ruc Yersinia ruckeri Bacterium00F—TGCCGCGTGTGTGAAGAA0.93Glenn et al .…”

A survey of microparasites present in adult migrating Chinook salmon (Oncorhynchus tshawytscha) in south‐western British Columbia determined by high‐throughput quantitative polymerase chain reaction

“…Mitchell et al . () found ‘ Ca . B. cysticola’ to be highly prevalent over a 7‐year period from a large geographical area in Norway and Ireland.…”

Investigation of co‐infections with pathogens associated with gill disease in Atlantic salmon during an amoebic gill disease outbreak

“…The microsporidian has been found in high prevalence regardless of an actual diagnosis of clinical PGI in Norway; however, it was detected at 30 times greater abundance in fish with confirmed outbreaks than in unaffected fish (Matthews et al., ; Steinum et al., ). Additionally, Candidatus Branchiomonas cysticola has been identified as the main agent of epitheliocystis in Norway, and a relationship has been previously described between the epitheliocysit load and severity of PGI (Mitchell et al., ; Toenshoff et al., ). Some variation in opinion exists as to whether or not epitheliocystis is of significance, as some findings have been considered to be incidental during a study in Tasmania (Clark & Nowak, ).…”