Capacity of a natural strain of woodchuck hepatitis virus, WHVNY, to induce acute infection in naive adult woodchucks

Abstract

Woodchuck hepatitis virus (WHV) is often used as surrogate to study mechanism of HBV infection. Currently, most infections are conducted using strains WHV7 or WHV8 that have very high sequence identity. This study focused on natural strain WHVNY that is more genetically distant from WHV7. Three naive adult woodchucks inoculated with WHVNY developed productive acute infection with long lasting viremia. However, only one of two woodchucks infected with WHV7 at the same multiplicity demonstrated productive liver infection. Quantification of intracellular WHV RNA and DNA replication intermediates; percentages of core antigen-positive hepatocytes; and serum relaxed circular DNA, showed that strains WHVNY and WHV7 displayed comparable replication levels and capacities to induce acute infection in naive adult woodchucks. Strain WHVNY was therefore validated as valuable reagent to analyze the mechanism of hepadnavirus infection, especially in co- and super-infection settings, which required discrimination between two related virus genomes replicating in the same liver.

Infection Patterns Induced in Naive Adult Woodchucks by Virions of Woodchuck Hepatitis Virus Collected during either the Acute or Chronic Phase of Infection

“…Our results suggested (i) that hepadnavirus cell-to-cell spread and superinfection continue during chronic hepadnavirus infection and (ii) that spread and superinfection, while being limited, still may represent the determinants of maintenance of chronic infection (15). In a separate study, we compared strains WHV7 and WHVNY and concluded that the two strains were quite similar in terms of their replication parameters and the ability to induce productive acute infection in naive adult woodchucks (16). This result was consistent with the interpretation that the observed limited efficiency of WHVNY superinfection in vivo (15) was not mediated by the properties of WHVNY virions but rather reflected the properties of hepatocytes residing in livers chronically infected with WHV7.…”

“…All experimental manipulations of animals have been performed under protocols approved by the Institutional Animal Care and Use Committee. Woodchucks F7386, M7297, and M7391 received as inoculum serum-derived WHV collected from woodchuck F6693 (16) at the peak of viremia during acute infection (week ϩ7 after inoculation). Animals M7393, F7238, and M7379 were infected with serum WHV harvested from woodchuck M1001 at the stage of early chronic infection (12 months postinoculation), when HCC was not yet developed.…”

“…The calibration of the assay was performed using 10-fold dilution series of plasmid pUC-CMVWHV, which was linearized with NheI. A range from 20 ϫ 10 7 to 2.0 ϫ 10 7 GE of WHV was used to obtain the calibration curve (16,19). The qPCR employed primer 23 (2504-AG AAGACGCACTCCCTCTCCT-2524), primer 24 (2579-TGGCAGATGG AGATTGAGAGC-2559), and TaqMan probe 28 (2531-/6-FAM/AGAAG ATCTCAATCACCGCGTCGCAG/3BHQ_1/-2556).…”

“…The harvested liver tissues were prepared and stained as previously described using the antibodies against the core antigen of WHV (WHcAg) (16,19). The WHcAg-positive and WHcAg-negative cells were identified manually, and then TMARKER software was employed for counting the fraction of WHcAg-positive cells (22).…”

“…The quantification of the percentage of serum WHV virions bound to anti-WHsAg antibodies in the inocula used was conducted as previously described (16). Briefly, each serum aliquot was incubated with 100 l of Pansorbin (Calbiochem) in Williams' E medium (the total volume of the mixture was 1 ml) using a rocking platform.…”