CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus

Abstract

bVibrio parahaemolyticus is commonly resistant to ampicillin, yet the mechanisms underlying this phenomenon are not clear. In this study, a novel class A carbenicillin-hydrolyzing ␤-lactamase (CARB) family of ␤-lactamases, bla CARB-17 , was identified and found to be responsible for the intrinsic penicillin resistance in V. parahaemolyticus. Importantly, bla CARB-17 -like genes were present in all 293 V. parahaemolyticus genome sequences available in GenBank and detectable in all 91 V. parahaemolyticus food isolates, further confirming the intrinsic nature of this gene. Vibrio parahaemolyticus is a major causative agent of gastroenteritis in areas with high seafood consumption rates and has recently become pandemic due to the emergence of the serotype O3:K6 (1). In Hong Kong, V. parahaemolyticus is the leading cause of food-borne illnesses due to the high rate of seafood consumption among the population (2). Although most cases of infections are self-limiting, fatality can occur among immunocompromised patients or those with debilitating medical conditions such as liver disease or diabetes (3). Antibiotics such as ciprofloxacin can be used for the treatment of infections caused by V. parahaemolyticus strains, but the choice of antibiotics should be based on the antimicrobial susceptibilities of the organism. V. parahaemolyticus is commonly considered highly susceptible to virtually all antimicrobials except for penicillins. However, mechanisms mediating the development of penicillin resistance in V. parahaemolyticus are not clear. In this study, we identified a novel carbenicillin-hydrolyzing ␤-lactamase (CARB) from chromosome 2 of V. parahaemolyticus and showed that the product of this gene is responsible for the intrinsic resistance to penicillins in V. parahaemolyticus.A novel potential ␤-lactamase gene, bla V110 , with a length of 852 bp was identified through bioinformatics analysis of the whole-genome sequence of V. parahaemolyticus V110, which was shown to be resistant to ampicillin (4). The full-length novel ␤-lactamase gene was amplified by PCR using primer set F-GCT GAGAGCTCATGAAAAAGTTA, R-CGTAGGATCCTTAACTT TCTTTGTAGTGC and then cloned into Escherichia coli BL21 and tested for the MICs of various ␤-lactams according to CLSI standards (5). E. coli BL21 isolates expressing the novel ␤-lactamase gene exhibited MICs of 256, 512, 256, and 1,024 g/ml toward penicillin G, ampicillin, carbenicillin, and piperacillin, respectively. The Bla V110 enzyme appears to be susceptible to ␤-lactamase inhibitors such as clavulanic acid, sulbactam, and tazobactam (Table 1). To verify whether the penicillin resistance phenotype was attributed to the expression of bla V110 , we further purified a truncated form (60 to 852 bp) of this ␤-lactamase in which the signal peptide was removed and designated mBla V110 . The mBla V110 protein was purified through several steps, including a Ni-nitrilotriacetic acid (NTA) column, thrombin treatment to remove the His tag, and a size exclusion column as previously described (6) (see Fig....

Prevalence, Virulence Characterization, AMR Pattern and Genetic Relatedness of Vibrio parahaemolyticus Isolates From Retail Seafood of Kerala, India

“…Our study and the previous reports indicate that V. parahaemolyticus is increasingly becoming resistant toward third and fourth generation Cephalosporins (Vaseeharan et al, 2005;Saifedden et al, 2016;Yu et al, 2016;Lee et al, 2018;Park et al, 2018). The resistance toward ampicillin observed in V. parahaemolyticus isolates (79.3%) used in this study is comparable with the intrinsic resistance toward ampicillin shown by this bacterium elsewhere (Sudha et al, 2014;Chiou et al, 2015;Elmahdi et al, 2016;Yu et al, 2016). Among the three isolates that showed a MAR index of 0.2 or above one was positive for PGS-PCR.…”

Vibrios from the Norwegian marine environment: Characterization of associated antibiotic resistance and virulence genes

“…Consistent with previous reports, a high prevalence of resistance to ampicillin was observed in all Vibrio spp. isolates in our study (Banerjee & Farber, 2018; Chiou, Li, & Chen, 2015; Hernández‐Robles et al., 2016; Li et al, 1999; Pan et al., 2013), and this resistance is usually due to the presence of a bla CARB gene (Chiou et al., 2015; Li et al., 2016). The bla CARB ‐ like genes have been found in V. cholerae predating the introduction of penicillins (Dorman et al., 2019).…”

Sensor histidine kinase is a β-lactam receptor and induces resistance to β-lactam antibiotics

“…Genes in the β-lactam resistance category include vp0040 encoding TetR transcriptional factor, vp0039 encoding HlyD membrane fusion protein, vp0454 encoding penicillin binding protein 3, vp0545 encoding β-hexosaminidase, vp2751 encoding penicillin binding protein 1A, and vpa0477 encoding a class A β-lactamase. The latter gene had the largest fold change (∼3.5 folds) between the WT and ΔvbrK mutant, and encodes a class A CARB β-lactamase (blaA) with 98.36% identity in nucleotide sequence and 98.59% identity in amino acid sequences to the recently described bla V110 (20). We performed RT-PCR analyses to verify that blaA is regulated by VbrK.…”

“…At the time we initiated these studies, there was minimal knowledge of the mechanisms underlying V. parahaemolyticus resistance to β-lactam antibiotics. However, a recent report revealed that essentially all V. parahaemolyticus isolates encode a class A chromosomal carbenicillin-hydrolyzing (CARB) β-lactamase (bla V110 ) (20). We Significance Bacteria can produce β-lactamases, enzymes that destroy β-lactam antibiotics and thereby resist these potent antibiotics that target cell wall synthesis.…”