Casein Kinase II Phosphorylates Lens Connexin 45.6 and Is Involved in Its Degradation

Abstract

Connexin (Cx) 45.6, an avian counterpart of rodent Cx50, is phosphorylated in vivo, but the sites and function of the phosphorylation have not been elucidated. Our peptide mapping experiments showed that the Ser 363 site in the carboxyl (COOH) terminus of Cx45.6 was phosphorylated and that this site is within casein kinase (CK) II consensus sequence, although showing some similarity to CKI sequence. The peptide containing Ser 363 could be phosphorylated in vitro by CKII, but not by CKI. Furthermore, CKII phosphorylated Cx45.6 in embryonic lens membrane and the fusion protein containing the COOH terminus of Cx45.6. Two-dimensional peptide mapping experiments showed that one of the Cx45.6 peptides phosphorylated in vivo migrated to the same spot as one of those phosphorylated by CKII in vitro. Furthermore, CKII activity could be detected in lens lysates. To assess the function of this phosphorylation event, exogenous wild type and mutant Cx45.6 (Ser 363 3 Ala) were expressed in lens primary cultures by retroviral infection. The mutant Cx45.6 was shown to be more stable having a longer half-life compared with wild type Cx45.6. Together, the evidence suggests that CKII is likely a kinase responsible for the Ser 363 phosphorylation, leading to the destablization and degradation of Cx45.6. The connexin degradation induced by phosphorylation has a broad functional significance in the regulation of gap junctions in vivo.Gap junctions are channels between two adjacent cells, which allow passage of small molecules (M r Յ 1000) such as small metabolites, ions, and second messengers. The gap junction-mediated cell-to-cell communications are important in maintaining cell and tissue functions (1). The structural components of gap junctions are members of a family of related membrane proteins called connexins, which consist of four conserved transmembrane domains and two extracellular loops, while their cytoplasmic regions are unique. The COOH terminus, the most variable region among connexins, contains several putative kinase consensus sequences. The phosphorylation of connexins has been indicated in the intracellular trafficking of connexins (2), channel assembly (3

Protein kinase CKII regulates the interaction of β-catenin withα-catenin and its protein stability

“…Our findings are in line with the demonstrated involvement of CKII in the proteolytic degradation of other proteins, e.g. IkBα and lens connexin 45.6 (Bren et al, 2000;Yin et al, 2000). Altogether it is concluded that a combined action of CKII and GSK-3β controls the cytoplasmic turnover of β-catenin.…”

Regulation of ΔFosB Stability by Phosphorylation

“…In fact, CK2 has been shown to be a prominent nuclear kinase (Krek et al, 1992) (for review, see Yu et al, 2001) and to interact with the bZIP domains of several transcription factors (Yamaguchi et al, 1998). CK2-mediated phosphorylation has also been shown to modulate the degradation (either enhancing or decreasing it) of many proteins, including IkB (Schwarz et al, 1996), PTEN (Torres and Pulido, 2001), lens connexin (Yin et al, 2000), chromatin-associated protein HMG1 (Wisniewski et al, 1999), and several transcription factors such as HMGB (Stemmer et al, 2002), Myf-5 (Winter et al, 1997), and c-Myc (Channavajhala and Seldin, 2002). CK2 is most abundant in brain (Alcazar et al, 1988;Girault et al, 1990), and its activity has been implicated in many aspects of brain function, including neuronal survival (Boehning et al, 2003), differentiation (Nuthall et al, 2004), ion channel function (Jones and Yakel, 2003;Bildl et al, 2004), and long-term potentiation and neuronal plasticity (Diaz-Nido et al, 1992;Lieberman and Mody, 1999;Reikhardt et al, 2003).…”

Promotion of lens epithelial-fiber differentiation by the C-terminus of connexin 45.6 – a role independent of gap junction communication

“…Anti-MIP(AQP0) polyclonal antibody was purchased from Alpha Diagnostics (San Antonio, TX); rhodamine-conjugated goat anti-mouse IgG and bicinchoninic acid (BCA) microprotein assay kit from Pierce Chemical ( Preparation of recombinant retroviral constructs encoding Cx45.6 and Cx45.6 mutant proteins and generation of hightiter retroviruses Retroviral constructs and high-titer retroviruses were prepared based on our protocol described previously (Jiang, 2001). In brief, a cDNA fragment containing wild-type Cx45.6 was made by PCR and was constructed into the retroviral vector RCAS(A) as described previously (Jiang and Goodenough, 1998;Yin et al, 2000). With the wild-type RCAS(A)-Cx45.6 DNA construct as a template, retroviral constructs of Cx45.6 mutants containing point mutations were generated with the QuikChange TM site-directed mutagenesis kit according to the manufacturer's instructions with the following pairs of primers: Cx45.6(D47A) (sense: CTAGTATGGGGAGCT -GAACA GTCAGAC, antisense: GTCTGACTGTTCAGCTCCCCATACTAG); Cx45.6(P88S) (sense: CATTTTTGTATCCACGTCTTCGCTAGTGTACTTTGGG, antisense: CCCAAAGTACACTAGCGAAGACGTGGATACAAAAATG).…”