CD Study of the G-Quadruplex Conformation

Kejnovská, Iva; Renčiuk, Daniel; Palacký, Jan; Vorlı́čková, Michaela

doi:10.1007/978-1-4939-9666-7_2

Cited by 33 publications

(32 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Specifically, we performed a preliminary study on 5 in H 2 O: EtOH 50:50 containing 5 mM of KCl, varying the pH of the solution by the addition of triethylamine (TEA). The choice of these operating conditions was made according to certain important factors, namely the ability of G-rich strands to fold into Q(s) in H 2 O: EtOH blends [ 58 , 59 , 60 ], thus allowing us to avoid using buffered solutions, such as 5 which has limited solubility (<10 µM).…”

Section: Resultsmentioning

confidence: 99%

Spectroscopic Properties of Two 5′-(4-Dimethylamino)Azobenzene Conjugated G-Quadruplex Forming Oligonucleotides

Imperatore

Varriale

Rivieccio

et al. 2020

IJMS

View full text Add to dashboard Cite

The synthesis of two 5′-end (4-dimethylamino)azobenzene conjugated G-quadruplex forming aptamers, the thrombin binding aptamer (TBA) and the HIV-1 integrase aptamer (T30695), was performed. Their structural behavior was investigated by means of UV, CD, fluorescence spectroscopy, and gel electrophoresis techniques in K+-containing buffers and water-ethanol blends. Particularly, we observed that the presence of the 5′-(4-dimethylamino)azobenzene moiety leads TBA to form multimers instead of the typical monomolecular chair-like G-quadruplex and almost hampers T30695 G-quadruplex monomers to dimerize. Fluorescence studies evidenced that both the conjugated G-quadruplexes possess unique fluorescence features when excited at wavelengths corresponding to the UV absorption of the conjugated moiety. Furthermore, a preliminary investigation of the trans-cis conversion of the dye incorporated at the 5′-end of TBA and T30695 showed that, unlike the free dye, in K+-containing water-ethanol-triethylamine blend the trans-to-cis conversion was almost undetectable by means of a standard UV spectrophotometer.

show abstract

Section: Resultsmentioning

confidence: 99%

Spectroscopic Properties of Two 5′-(4-Dimethylamino)Azobenzene Conjugated G-Quadruplex Forming Oligonucleotides

Imperatore

Varriale

Rivieccio

et al. 2020

IJMS

View full text Add to dashboard Cite

show abstract

“…The precise concentration of the oligonucleotides was determined from absorption at 260 nm in the above buffer at 90 °C using molar absorption coefficients calculated as stated in ref. [30]. Absorbance was measured on a UNICAM 5626 UV/Vis spectrometer (Cambridge, UK).…”

Section: Methodsmentioning

confidence: 99%

G‐Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Kejnovská

Stadlbauer

Trantı́rek

et al. 2021

Chemistry A European J

Self Cite

View full text Add to dashboard Cite

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

show abstract

“…G-quadruplexes are known to produce distinctive peaks in their CD spectra when formed, as seen for AS1411 (Figure S13b), and CD spectroscopy is used as a means to validate their presence. [62][63][64] In the case of AS1411, the distinctive CD signature includes a positive peak at around 260 nm and a negative peak at around 240 nm 63, 65 which were not observed when Ru was attached at the 3' end under these experimental conditions regardless on the concentration of K + . Nevertheless, an in vitro PDT assay was performed using MCF-7 (breast cancer), HT-29 (colorectal adenocarcinoma) and RPE-1 (retinal pigment epithelial) cell lines.…”

Section: Ru-as1411 Conjugatesmentioning

confidence: 85%

A ruthenium–oligonucleotide bioconjugated photosensitizing aptamer for cancer cell specific photodynamic therapy

et al. 2022

View full text Add to dashboard Cite

show abstract

CD Study of the G-Quadruplex Conformation

Cited by 33 publications

References 33 publications

Spectroscopic Properties of Two 5′-(4-Dimethylamino)Azobenzene Conjugated G-Quadruplex Forming Oligonucleotides

Spectroscopic Properties of Two 5′-(4-Dimethylamino)Azobenzene Conjugated G-Quadruplex Forming Oligonucleotides

G‐Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

A ruthenium–oligonucleotide bioconjugated photosensitizing aptamer for cancer cell specific photodynamic therapy

Contact Info

Product

Resources

About