Cell Type-Specific Profiling of Chromatin Modifications and Associated Proteins

Abstract

Progression of a cell along a differentiation path is characterized by changes in gene expression profiles. Alterations of these transcriptional programs result from cell type-specific transcription factors that act in a dynamic chromatin environment. Understanding the precise contribution of these molecular factors during the differentiation process requires accessing specific cell types within a developing organ. This chapter describes a streamlined and alternative version of INTACT, a method enabling the isolation of specific cell populations by affinity-purification of tagged nuclei and the subsequent analysis of gene expression, transcription factor binding profiles, as well as chromatin state at a genome-wide scale. In particular, modifications of the nuclei isolation, capture, and purification procedures are proposed that improve time scale, yield, and purity. In addition, the combination of different tags enables the analysis of distinct cell populations from a single transgenic line and the subtractive purification of subpopulations of cells, including those for which no specific promoter is available. Finally, we describe a chromatin immunoprecipitation protocol that has been successfully used to profile histone modifications and other chromatin-associated proteins such as RNA Polymerase II in different cell populations of the Arabidopsis root, including the quiescent center of the stem cell niche.

Probing the 3D architecture of the plant nucleus with microscopy approaches: challenges and solutions

“…Cell-specific nuclear-tagging-based approaches such as the INTACT method (Isolation of Nuclei TAgged in specific Cell Types) are becoming increasingly popular due to the growing resource of tagged lines [101][102][103]. However, a systematic application for characterizing the diversity of nuclear architecture among plant tissues remains lacking.…”

Genome-wide identification of RETINOBLASTOMA RELATED 1 binding sites in Arabidopsis reveals novel DNA damage regulators

“…However, previously described developmental RBR1 targets remain unmarked. To investigate RBR1's proposed role as a potential integrator of cell cycle regulation with developmental processes, genome-wide RBR1 distribution at specific developmental time points and in defined cell types will be beneficial and can be achieved by applying our optimized ChIP protocol in combination with FACS or INTACT methods [113,114].…”

Compensation of compromised PRC2 regulation by a miRNA ensures robustness of Arabidopsis leaf development

“…The promoter of the CUC2 gene was amplified with primers GGGGACAACTTTGTATAGAAAAGTTGGCACCTCCTTCATCAAATACG and GGGGACTGCTTTTTTGTACAAACTTGGAAAGATCTAAAGCTTTTGTTTGAGAG and cloned into the entry vector pENTR5’ (Life Technologies). The promoter of CUC2 was fused to a Nuclear Tagging Fusion (NTF) containing the GFP and a nuclear envelop-targetting domain, described in (Morao et al, 2018)) into the pB7m24GW, 3 vector (VIB-UGENT, Karimi et al, 2002) using Gateway technology and following the protocol of the LR Clonase II Plus Enzyme Mix (ThermoFischer). The final pCUC2:NTF-GFP vector was used to transform plant by floral dipping (Clough and Bent, 1998).…”

“…INTACT experiments were performed according to (Morao et al, 2018). Briefly, 500 mg of hand-dissected rosette centers from 6-week-old plants were harvested and frozen in liquid nitrogen.…”

“…The promoter of the CUC2 gene was amplified with primers in (Morao et al, 2018)) into the pB7m24GW, 3 vector (VIB-UGENT, Karimi et al, 2002) using Gateway technology and following the protocol of the LR Clonase II Plus Enzyme Mix (ThermoFischer). The final pCUC2:NTF-GFP vector was used to transform plant by floral dipping (Clough and Bent, 1998).…”