Changes of brain neuropeptide Y and its receptors in rats with flurazepam tolerance and dependence1

Zhang, Liping; Wang, Li

doi:10.1111/j.1745-7254.2005.00179.x

Cited by 12 publications

(10 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…They show strong links with brain, such as 1) Clobazam [43], 2) Chlordiazepoxide [44], 3) Midazolam [45], 4) Flurazepam [46], 5) Oxazepam [47], 6) Bromazepam [48], and 7) Nitrazepam [49]. …”

Section: Case Studiesmentioning

confidence: 99%

IPAD: the Integrated Pathway Analysis Database for Systematic Enrichment Analysis

Zhang

Drabier

2012

BMC Bioinformatics

View full text Add to dashboard Cite

BackgroundNext-Generation Sequencing (NGS) technologies and Genome-Wide Association Studies (GWAS) generate millions of reads and hundreds of datasets, and there is an urgent need for a better way to accurately interpret and distill such large amounts of data. Extensive pathway and network analysis allow for the discovery of highly significant pathways from a set of disease vs. healthy samples in the NGS and GWAS. Knowledge of activation of these processes will lead to elucidation of the complex biological pathways affected by drug treatment, to patient stratification studies of new and existing drug treatments, and to understanding the underlying anti-cancer drug effects. There are approximately 141 biological human pathway resources as of Jan 2012 according to the Pathguide database. However, most currently available resources do not contain disease, drug or organ specificity information such as disease-pathway, drug-pathway, and organ-pathway associations. Systematically integrating pathway, disease, drug and organ specificity together becomes increasingly crucial for understanding the interrelationships between signaling, metabolic and regulatory pathway, drug action, disease susceptibility, and organ specificity from high-throughput omics data (genomics, transcriptomics, proteomics and metabolomics).ResultsWe designed the Integrated Pathway Analysis Database for Systematic Enrichment Analysis (IPAD, http://bioinfo.hsc.unt.edu/ipad), defining inter-association between pathway, disease, drug and organ specificity, based on six criteria: 1) comprehensive pathway coverage; 2) gene/protein to pathway/disease/drug/organ association; 3) inter-association between pathway, disease, drug, and organ; 4) multiple and quantitative measurement of enrichment and inter-association; 5) assessment of enrichment and inter-association analysis with the context of the existing biological knowledge and a "gold standard" constructed from reputable and reliable sources; and 6) cross-linking of multiple available data sources.IPAD is a comprehensive database covering about 22,498 genes, 25,469 proteins, 1956 pathways, 6704 diseases, 5615 drugs, and 52 organs integrated from databases including the BioCarta, KEGG, NCI-Nature curated, Reactome, CTD, PharmGKB, DrugBank, PharmGKB, and HOMER. The database has a web-based user interface that allows users to perform enrichment analysis from genes/proteins/molecules and inter-association analysis from a pathway, disease, drug, and organ.Moreover, the quality of the database was validated with the context of the existing biological knowledge and a "gold standard" constructed from reputable and reliable sources. Two case studies were also presented to demonstrate: 1) self-validation of enrichment analysis and inter-association analysis on brain-specific markers, and 2) identification of previously undiscovered components by the enrichment analysis from a prostate cancer study.ConclusionsIPAD is a new resource for analyzing, identifying, and validating pathway, disease, drug, organ specificity...

show abstract

Section: Case Studiesmentioning

confidence: 99%

IPAD: the Integrated Pathway Analysis Database for Systematic Enrichment Analysis

Zhang

Drabier

2012

BMC Bioinformatics

View full text Add to dashboard Cite

show abstract

“…In brief, RNA was extracted from adrenal medullae by using Trizol and was reverse transcribed by using superscript III reverse transcriptase. Primer sequences for realtime PCR amplification were as follows: 18S forward (fw), GTAACCCGTTGAACCCCATT; 18S reverse (rev), CCATCC AATCGGTAGTAGCG (151 base pair) and ppNPY: (fw) 5'-TATCCCTGCTCGTGTGTTTG-3' and (rev) 5'-AACGACAA CAAGGGAAATGG-3' (386 base pairs) (75). Relative mRNA level was calculated by using the comparative threshold (CT) method with the formula 2 ÀCT where CT is the difference between the threshold cycle of the given target cDNA between control (normoxia) and IH.…”

mentioning

confidence: 99%

Enhanced Neuropeptide Y Synthesis During Intermittent Hypoxia in the Rat Adrenal Medulla: Role of Reactive Oxygen Species–Dependent Alterations in Precursor Peptide Processing

Raghuraman

Kalari

Dhingra

et al. 2011

Antioxidants & Redox Signaling

View full text Add to dashboard Cite

Intermittent hypoxia (IH) associated with recurrent apneas often leads to cardiovascular abnormalities. Previously, we showed that IH treatment elevates blood pressure and increases plasma catecholamines (CAs) in rats via reactive oxygen species (ROS)-dependent enhanced synthesis and secretion from the adrenal medulla (AM). Neuropeptide Y (NPY), a sympathetic neurotransmitter that colocalizes with CA in the AM, has been implicated in blood pressure regulation during persistent stress. Here, we investigated whether IH facilitates NPY synthesis in the rat AM and assessed the role of ROS signaling. IH increased NPY-like immunoreactivity in many dopamine-β-hydroxylase-expressing chromaffin cells with a parallel increase in preproNPY mRNA and protein. IH increased the activities of proNPY-processing enzymes, which were due, in part, to elevated protein expression and increased proteolytic processing. IH increased ROS generation, and antioxidants reversed IH-induced increases in ROS, preproNPY, and its processing to bioactive NPY in the AM. IH treatment increased blood pressure and antioxidants and inhibition of NPY amidation prevented this response. These findings suggest that IH-induced elevation in NPY expression in the rat AM is mediated by ROS-dependent augmentation of preproNPY mRNA expression and proNPY-processing enzyme activities and contributes to IH-induced elevation of blood pressure.

show abstract

“…Indeed connections between tolerance and dependence and alterations of cortical NPY levels have been reported. In rats exhibiting anticonvulsant tolerance and dependence due to flurazepam treatment NPY imunoreactivity was found to be significantly decreased in the hippocampus (Zhang and Wang, 2005). Zhang et al also investigated a positive correlation between the expression of NPY in the hippocampus and the degree of tolerance and dependence.…”

Section: Possible Neuroendocrine Mechanisms Of Benzodiazepine Dependencementioning

confidence: 99%

“…Inhibition of basal and metyrapone induced ACTH and cortisol secretion (Deuster et al, 2005) Humans (male, 20-45 years)/Alprazolam Decrease in plasma cortisol, ACTH, AVP and DHEA responses to exercise Humans (female, 25-32 years)/Alprazolam/ canrenoate Inhibition of basal and canrenoate induced ACTH and cortisol secretion (Torpy et al, 1994) Humans/Alprazolam Inhibition of AVP stimulated ACTH and cortisol release CRF Preclinical studies (Imaki et al, 1995) Male albino rats/restrained stress/ Chlordiazepoxide Inhibition of CRF mRNA and ACTH increase due to restrained stress (Skelton et al, 2004) Rats/Alprazolam Correlation between withdrawal from alprazolam and activation of the HPA axis and increase of cortical CRF mRNA expression (Kalogeras et al, 1990) Non human primates/Rats cortical cell cultures /Alprazolam Dose dependent inhibition of plasma ACTH and cortisol secretion in vivo; dose dependent inhibition of 5HT-induced CRF release in vitro (Calogero et al, 1988) Rat hypothalamic culture/Diazepam Inhibiton of 5HT-induced CRF release NPY Preclinical Studies (Krysiak et al, 2000) Rat cortical cell culture/Diazepam Reversal of fear induced changes in NPY-like immunoreactivity (Zhang and Wang, 2005) Rat cortical cell culture/flurazepam Decrease in preproNPY mRNA in the hippocampus and a decrease of NPY immunoreactive material in the CA1, CA3 and dentate gyrus regions in tolerant and dependent rats. Alterations in Y1, Y2 and Y5 mRNA expression in both groups.…”

Section: Acth Cortisolmentioning

confidence: 99%

Neuroendocrine pathways in benzodiazepine dependence: new targets for research and therapy

Heberlein

Bleich

Kornhuber

et al. 2007

Human Psychopharmacology

View full text Add to dashboard Cite

Benzodiazepines are known to modulate the activity of the hypothalamo-pituitary-adrenocortical (HPA) axis by antagonizing the effects of corticotropin-releasing factor (CRH). Besides regulating the HPA axis CRH evolves properties of a neurotransmitter in the limbic system that is closely involved in the delivery of the emotional consequences of the stress response. At a superordinated level Neuropeptide Y (NPY) and Cholecystokinin (CCK) affect the release of CRH and modulate thereby the intensity of the physiological stress response. Benzodiazepine treatment interferes not only with the release of CRH but also with the release of NPY and CCK. Alterations in the intracortical ratio of NPY, CCK and CRH are correlated with behavioural changes like increased respectively decreased anxiety and subsequent alterations in the activity of the HPA axis. Recent research offers the possibility that the alterations of plasma levels of these neuropeptides are not only a secondary phenomenon due to drug intake, but that low levels of those neuropeptides that modulate anxiety and fear can possibly explain addiction to substances that counterbalance these deficits. Depending on the available results possible implications of NPY and CCK on benzodiazepine addiction and withdrawal symptoms are reviewed, thereby providing topics for further research.

show abstract

Changes of brain neuropeptide Y and its receptors in rats with flurazepam tolerance and dependence1

Cited by 12 publications

References 27 publications

IPAD: the Integrated Pathway Analysis Database for Systematic Enrichment Analysis

IPAD: the Integrated Pathway Analysis Database for Systematic Enrichment Analysis

Enhanced Neuropeptide Y Synthesis During Intermittent Hypoxia in the Rat Adrenal Medulla: Role of Reactive Oxygen Species–Dependent Alterations in Precursor Peptide Processing

Neuroendocrine pathways in benzodiazepine dependence: new targets for research and therapy

Contact Info

Product

Resources

About