Characteristics of Lactobacillus and Gardnerella vaginalis from women with or without bacterial vaginosis and their relationships in gnotobiotic mice

Abstract

The objectives of the present study were to evaluate in vitro the production of antagonistic compounds against Gardnerella vaginalis by Lactobacillus strains isolated from women with or without bacterial vaginosis (BV), and to select one of the better Lactobacillus producers of such a substance to be tested in vivo using a gnotobiotic animal model challenged with one of the more sensitive G. vaginalis isolates. A total of 24 isolates from women with and without BV were identified as G. vaginalis. A higher frequency (P,0.05) of this bacterium was observed in women with BV (56.7 %) when compared to healthy women (17.6 %). A total of 86 strains of Lactobacillus were obtained from healthy women and women with BV. Lactobacillus strains were more frequently present (P,0.05) in healthy women (97.5 %) than in women with BV (76.7 %). Lactobacillus crispatus was the predominating strain in both healthy women and women with BV. Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus gasseri and Lactobacillus vaginalis were isolated with an intermediate frequency in the two groups. In vitro antagonism assays were performed using as indicators 17 reference strains and the G. vaginalis strains isolated from women with BV and from healthy women. Lactobacillus isolated from healthy women showed the higher antagonistic activity against all the indicator strains when compared with isolates from women with BV. Concerning the indicator strains, G. vaginalis found in women with BV was more resistant to the antagonism, particularly when Lactobacillus isolates from women with BV were used as producer strains. A high vaginal population level of G. vaginalis was obtained by intravaginal inoculation of germ-free mice, and this colonization was accompanied by vaginal histopathological lesions. A tenfold decrease in vaginal population level of G. vaginalis and a reduction of histological lesions were observed when the pathogenic challenge was performed in mice previously monoassociated with an L. johnsonii strain. Concluding, results of the present study suggest that progression of G. vaginalis-associated BV depends in part on a simultaneous presence of Lactobacillus populations with a low antagonistic capacity and of a G. vaginalis strain with a high resistance to this antagonism. The results could also explain why G. vaginalis is frequently found in the vaginal ecosystem of healthy women.

Penile Microbiota and Female Partner Bacterial Vaginosis in Rakai, Uganda

“…After exposure, CST1 to 3 may confer resistance to the establishment of BV-associated bacteria via antagonistic interactions, such as resource competition (29–32), antimicrobial production (33), stimulation of the immune system (34, 35), or predation (36). Even though little is known regarding antagonistic effects of male genital commensals, in vitro and coculture studies indicate that the vaginal commensal Lactobacillus could inhibit BV-associated bacteria (37–39). Thus, a possible explanation for the imperfect concordance between penile microbiota and female partner Nugent score is that penile microbiota composition influences the outcome from exposure to vaginal bacteria.…”

Clinical Features of Bacterial Vaginosis in a Murine Model of Vaginal Infection with Gardnerella vaginalis

“…Although possibly explained by a difference in mouse strain used or conditions of the housing or breeding facility, there was also no reference to the incidence of contaminating vaginal flora, which we found invariably present in our mouse model. In addition to these two studies, there is one report of vaginal G. vaginalis infection in gnotobiotic mice [65], which naturally circumvents the issue of contaminating flora.…”

Selection of Lactobacillus strains as potential probiotics for vaginitis treatment

“…DNA extraction of Lactobacillus strains was carried out according to Teixeira et al (2012). The 16S rDNA was amplified using the oligonucleotides SAdir (5¢AGAGTTTGATCATGGCTCAG3¢) and S17rev (5¢GTTACCTTGTTACGACTT3¢), which correspond to the positions 8-28 and 1493-1508, respectively, of the 16S rRNA gene of E. coli, (Wery et al, 2001 Altschul et al, 1990).…”

“…The antagonist activity of the 23 Lactobacillus isolates was evaluated by the double layer agar diffusion assay as described by Teixeira et al (2012). Aliquots of 5 µl from Lactobacillus cultures containing 10 9 colony forming units (CFU) ml -1 were spotted on plates containing MRS agar.…”