Characterization and sequence verification of thiolated deoxyoligonucleotides used for microarray construction

Abstract

During synthesis of thiolated deoxyoligonucleotides, side products can be formed. When used in the fabrication of microchips, the oligonucleotides have to be of high purity. We demonstrated the presence of impurities, which were not failure sequences from the synthesis. These products were identified and characterized using high-performance liquid chromatography (HPLC) and electrospray MS(/MS). The presence of the free thiol group was assessed by acrylamide derivatization. After reaction with acrylamide the correct compounds showed a 71 u mass shift and the major fragment ions could be assigned as 5= a-base and 3= w ions, similar as for unmodified DNA. The side products were unaffected by acrylamide, suggesting that the thiol group was modified. The oligonucleotide containing a species with a mass of 32 u higher was identified as 5= sulfinic acid containing molecule and was found as 45% of the total amount of a DNA 25 mer. Other components appeared to be dithio-linked oxidation products, present about 1 to 5% in a 10 mer and 15 mer deoxyoligonucleotide. The analyses were useful for optimizing the synthesis

Increased stability of mercapto alkane functionalized Au nanoparticles towards DNA sensing

“…Upon further increase of the NaCl concentration the absorbance at 518 nm decreased and a second band in the UV-vis spectrum was observed around 700 nm, indicating nanoparticle aggregation. This additional band is a result of plasmon coupling and is in agreement with previous reports [27]. The observed aggregation can largely be explained by the DLVO theory (Derjaguin, Landau, Verwey, Overbeek [45]) which states that the stability of a colloidal suspension is determined by an electrostatic repulsive, Coulombic force, which drives particles apart and by attractive van der Waals forces which promote particle aggregation.…”

“…Additionally, the UV-vis absorption spectra of the GNPs showed a very narrow plasmon bandwidth of 75 nm, centered at 518 nm, confirming the observations made by TEM and DLS. From all these observations, and assuming total reduction of the gold salt, the concentration of the citrate capped gold nanoparticles was calculated to be 1.4 × 10 12 nanoparticles ml −1 , which is in agreement with previous reports [27,36].…”

“…All other chemicals, including tetra-chloroauric acid (HAuCl 4 ) and 6-mercaptohexanoic acid (SH(CH 2 ) 5 COOH) (1), 11mercaptoundecanol SH(CH 2 ) 11 OH (3) and 11-mercaptoundecanoic acid (SH(CH 2 ) 10 COOH) (4) were obtained from Sigma-Aldrich (Missouri, USA). The oligonucleotide used, a probe of 25 nucleotides (5 TTCACAGGTACTGGATTTGATT GTG) (25-nct), was synthesized and modified with a 5mercapto-11-undecyl hexa(ethylene oxide) linker (25-nct-11) by Van Aerschot [27]. The same oligonucleotide and its complementary probe (5 CACAATCAAATCCAGTACCTGT GAA) (25-nct-c) were modified both with a 5 -mercaptohexanol linker (25-nct-6, 25-nct-c-6) and derived from Eurogentec (Seraing, Belgium).…”

Enzymatic Formation of PEGylated Oligonucleotides

“…5,6 Presently, the PEGylation of nucleic acids is based on the covalent attachment of a properly activated PEGylating agent to the 3′ thiol-or amino-modified DNA or RNA oligonucleotide. 2,3 Consequently, the preparation of modified nucleic acids is an obligate step that might present some constraints, such as the formation of impurities 7,8 and additional steps with increasing costs especially when dealing with long sequences.…”

“…PEGylation, the covalent attachment of polyethylene glycol (PEG) has been proposed for prolonging the pharmacokinetic profile of nucleic acid materials in gene therapy, RNAi, and for the delivery of nucleic acid based therapeutics as aptamers. − PEGylated oligonucleotides and siRNAs have demonstrated an improved cell internalization and stability with respect to the free nucleic acids. , Presently, the PEGylation of nucleic acids is based on the covalent attachment of a properly activated PEGylating agent to the 3′ thiol- or amino-modified DNA or RNA oligonucleotide. , Consequently, the preparation of modified nucleic acids is an obligate step that might present some constraints, such as the formation of impurities , and additional steps with increasing costs especially when dealing with long sequences.…”