1996
DOI: 10.1111/j.1399-302x.1996.tb00196.x
|View full text |Cite
|
Sign up to set email alerts
|

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Abstract: Oral anaerobic treponemes are assoicated with active periodontal disease and may comprise up to 57% of the microbiota in periodontal pockets. Four treponeme strains (designated U2a, U2b, U9b, and U9c) isolated from clincial cases were found to harbor a new 4.2-kb plasmid when plasmid DNA was extracted and purified employing the Qiagen Plasmid Kit. This plasmid differs from the smaller plasmids (2.0-, 2.6-, and 2.7-Kb) reported previously by others in Treponema denticola. The newly discovered 4.2-kb plasmid was… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1

Citation Types

0
14
0
1

Year Published

1998
1998
2015
2015

Publication Types

Select...
7
1

Relationship

0
8

Authors

Journals

citations
Cited by 22 publications
(15 citation statements)
references
References 9 publications
0
14
0
1
Order By: Relevance
“…Several of them revealed to be invasive in vivo and in vitro [94,95]. Six different periodontal pathogen spirochetes, specifically, T. denticola , T. pectinovorum, T. vincenti, T. amylovorum, T. maltophilum, T. medium and T. socranskii were detected in the brains of AD patients using species specific PCR.…”
Section: Association Of Spirochetes and Alzheimer's Diseasementioning
confidence: 99%
“…Several of them revealed to be invasive in vivo and in vitro [94,95]. Six different periodontal pathogen spirochetes, specifically, T. denticola , T. pectinovorum, T. vincenti, T. amylovorum, T. maltophilum, T. medium and T. socranskii were detected in the brains of AD patients using species specific PCR.…”
Section: Association Of Spirochetes and Alzheimer's Diseasementioning
confidence: 99%
“…coli-T. denticola shuttle plasmids. Available shuttle plasmids for T. denticola are all based on pTS1, a cryptic plasmid from an oral Treponema clinical isolate (2,15). For these studies, we used pBFC (16), which encodes resistance to Km in E. coli and Cm in T. denticola (Fig.…”
Section: Methodsmentioning
confidence: 99%
“…To prepare methylated pBFC, the plasmid was transformed into E. coli TOP10, which contains the dam gene encoding a DNA methyltransferase that methylates the N 6 position of the adenine residues in the sequence GATC (18,20). To prepare unmethylated CACTATCTAATATGAACAAAAATATAAAATATTCTC ermB cassette; F P 4 CCAGATTTTTTTTATTTCCTCCCGTTAAATAATAG ermB cassette; R P 5 GAGGAAATAAAAAAAATCTGGATTTGTGTATGT 3Ј-flanking region of TDE0911; F P 6 CACACGTAAAACAGATGAC 3Ј-flanking region of TDE0911; R P 7 CTAATCAACAAATAATACAGGTC TDE0911 probe; F P 8 CTATCTATGCTGTGCAAAATAG TDE0911probe; R P 9 CGAATGAAAAGGTACTCAACC ermB probe; F P 10 CCTCCCGTTAAATAATAG ermB probe; R P 11 CCAAATGATGCTTATGTTGC TDE0228 probe; F P 12 CCAAGTAAATTCTTGTTGCT TDE0228 probe; R P 13 CTCAGATAGTAAGGGTGT TDE1268 probe; F P 14 GGAGTTGTTGTCTTATCT TDE1268 probe; R P 15 GCACATGTAGGCTCAGCCCTGACCAAGTC aacC1 site mutagenesis; F P 16 GACTTGGTCAGGGCTGAGCCTACATGTGC aacC1site mutagenesis; R P 17 ATGTTACGCAGCAGCAACG aacC1 cassette; F P 18 TTAGGTGGCGGTACTTGGG aacC1cassette; R P 19 GAGCAACCAGAAATTGTTC 3Ј-flanking region of P 6 ; R a Underlined portions show the engineered overlapping base pairs. b Primer orientation: F, forward; R, reverse.…”
Section: Methodsmentioning
confidence: 99%
“…In addition, four plasmids have been isolated from several oral treponemes, including ATCC 33520, but none of these plasmids has been isolated from ATCC 35405 (4,5). Moreover, three shuttle vectors (pKMR4PE, pKMCou, and pBFC) that were derived from the plasmid pTS1 have been successfully transferred into ATCC 33520 but not ATCC 35405 (5,9,10,44). Thus far, there has been no shuttle vector available for the genetic complementation of mutants derived from T. denticola ATCC 35405.…”
mentioning
confidence: 99%
See 1 more Smart Citation