Characterization of Fluorescent Chimeras of Cholera Toxin and Escherichia coli Heat-Labile Enterotoxins Produced by Use of the Twin Arginine Translocation System

Abstract

Cholera toxin (CT) is an AB 5 toxin responsible for the profuse secretory diarrhea resulting from Vibrio cholerae infection. CT consists of a pentameric, receptor-binding B subunit (CTB) and a monomeric A subunit (CTA) that has latent enzymatic activity. In addition to its enterotoxicity, CT has potent mucosal adjuvant activity and can also function as a carrier molecule with many potential applications in cell biology. In earlier studies, the toxic CTA 1 domain was replaced by several other antigenic protein domains to produce holotoxinlike chimeras for use as potential mucosal vaccines. In the present study we utilized the twin arginine translocation (tat) system to produce fluorescent CT chimeras, as well as fluorescent chimeras of Escherichia coli heat-labile toxins LTI and LTIIb. Fusion proteins containing either green fluorescent protein (GFP) or monomeric red fluorescent protein (mRFP) and the A 2 domain of CT, LTI, or LTIIb were transported to the periplasm of E. coli by the tat system, and the corresponding B polypeptides of CT, LTI, and LTIIb were transported to the periplasm by the sec system. The fluorescent fusion proteins were shown to assemble spontaneously and efficiently with the corresponding B polypeptides in the periplasm to form chimeric holotoxin-like molecules, and these chimeras bound to and entered cultured cells in a manner similar to native CT, LTI, or LTIIb. The GFP and mRFP derivatives of CT, LT, and LTIIb developed here are useful tools for studies on the cell biology of trafficking of the CT/LT family of bacterial enterotoxins. In addition, these constructs provide proof in principle for the development of novel chimeric CT-like or LT-like vaccine candidates containing CTA 2 fusion proteins that cannot be delivered to the periplasm of E. coli by use of the sec secretion pathway.The AB 5 -type enterotoxins produced by Vibrio cholerae and Escherichia coli have generated interest as potent mucosal adjuvants and immunomodulators, as well as molecular tools to study endocytosis and trafficking from the cell surface to the endoplasmic reticulum (ER) (14,25). Cholera toxin (CT) and E. coli type I heat-labile enterotoxin (LTI) are approximately 80% identical at the amino acid level and consist of an enzymatically active A subunit and a pentameric, receptor-binding B subunit. The B subunit of CT (CTB) binds to ganglioside GM 1 and triggers uptake of the toxin into epithelial cells by endocytosis. Subsequent reduction of the proteolytically nicked A subunit (CTA) releases the active CTA 1 fragment within the endoplasmic reticulum, and CTA 1 is then translocated to the host cytoplasm to catalyze ADP-ribosylation of Gs␣ (25). The E. coli type II enterotoxins, LTIIa and LTIIb, are structurally and functionally homologous to CT and LTI; however, they are more divergent at the amino acid sequence level, and their pentameric B subunits bind preferentially to different ganglioside receptors.Our laboratory and others have constructed stable holotoxin-like molecules with another protein of interest r...

Mucosal Immunization with a Staphylococcus aureus IsdA-Cholera Toxin A2/B Chimera Induces Antigen-Specific Th2-Type Responses in Mice

“…To direct the IsdA-CTA 2 and CTB peptides of the chimera to the E. coli periplasm for proper holotoxin assembly, pBA001 (Fig. 1A) was constructed from pARLDR19, which utilizes the E. coli LTIIb N-terminal leader sequence (57). Induction of pBA001 and purification from the periplasm of E. coli resulted in efficient IsdA-CTA 2 /B production (3 to 4 mg from 1 liter of starting culture).…”

“…To construct pBA001 for the expression of IsdA-CTA 2 /B, isdA was PCR amplified from MRSA252 with primers that add 5Ј SphI (GCTACTGGC ATGCGGCAACAGAAGCTACGAAC) and 3Ј ClaI (GTGCATGATCGATTT TGGTAATTCTTTAGC) sites (in boldface) and cloned into pARLDR19 (kindly provided by R. K. Holmes, University of Colorado Health Sciences Center [UCHSC], Denver, CO) between the LTIIb leader sequence and ctxA 2 . CTB is also expressed from this vector, which has been described previously (55,57). To make His 6 -IsdA, isdA was amplified from MRSA252 with primers that add 5Ј BamHI (GCTACTGGATCCGCGGCAACAGAAGCTACGAAC or GT GCATAAGCTTTCAAGTTTTTGGTAATTCTTTAGC) and 3Ј HindIII (GTG CATGATCGATTTTGGTAATTCTTTAGC) sites (in boldface) and cloned into pTrcHisA (Invitrogen, Carlsbad, CA) or pET-40bϩ (Novagen, Madison, WI), yielding pBA009A and pBA015.…”

Functional Analysis of the Twin-Arginine Translocation Pathway in Corynebacterium glutamicum ATCC 13869

“…Only the Tat pathway is capable of exporting folded GFP (15,44); hence, GFP has been widely used as a substrate to assess the Tat function in various bacteria and chloroplasts (13,14,30,41,49,51). We used GFP (39) as a substrates to assess the Tat function in C. glutamicum.…”

The Bacterial Twin-Arginine Translocation Pathway

“…Tinker et al (126) used the Tat pathway for the export of GFP fused to the A subunit of cholera toxin or the heat-labile toxins LT1 and LTIIb. Concomitant export of the respective B subunits via the Sec apparatus resulted in the formation of active and fluorescent holotoxin fusions in the periplasm.…”