Characterization of horse (Equus caballus) T-cell receptor beta chain genes

Abstract

Genes encoding the horse (Equus caballus) T-cell receptor beta chain (TCRB) were cloned and characterized. Of 33 cDNA clones isolated from the mesenteric lymph node, 30 had functionally rearranged gene segments, and three contained germline sequences. Sixteen unique variable segments (TCRBV), 14 joining genes (TCRBJ), and two constant region genes (TCRBC) were identified. Horse TCRBV were grouped into nine families based on similarity to human sequences. TCRBV2 and TCRBV12 were the most commonly represented horse families. Analysis of predicted protein structure revealed the presence of conserved regions similar to those seen in TCRB of other species. A decanucleotide promoter sequence homologous to those found in humans and mice was located in the 5' untranslated region of one horse gene. Germline sequences included the 5' region of the TCRBD2 gene with flanking heptamer/nonamer recombination signals and portions of the TCRBJ2-C2 intron. Southern blot hybridizations demonstrated restriction fragment length polymorphisms at the TCRBC locus among different horse breeds.

Analyses of TCRB Rearrangements Substantiate a Profound Deficit in Recombination Signal Sequence Joining in SCID Foals: Implications for the Role of DNA-Dependent Protein Kinase in V(D)J Recombination

“…To analyze early TCR rearrangements from SCID thymocytes, the intervening region between TCR D B 2 and TCR J B 2.1 was amplified from spleen DNA using amplification primers derived from published equine TCR B transcripts ( Fig. 1) (50). As can be seen, a single hybridizing band of ϳ800 bp is present in amplifications of SCID spleen DNA (representing the germline configuration of the D B 2 and J B 2.1 genes), whereas two bands (ϳ800 and ϳ160 bp, representing unrearranged and rearranged, respectively) are apparent in amplifications from normal spleen DNA.…”

Cloning and large-scale expansion of epitope-specific equine cytotoxic T lymphocytes using an anti-equine CD3 monoclonal antibody and human recombinant IL-2

“…The 5' RACE procedure was used to obtain the variable region because the 5' portion of TCRβ genes is not conserved. The 3' reverse primers were chosen based on the conserved sequence in the equine TCRβ chain constant region (47). Fifteen cloned TCRβ genes from CTL clone R17-1005 were sequenced, and all were identical (Fig.…”

“…Total RNA was extracted from 5 × 10 7 cells using an RNeasy mini kit (Qiagen, Chatsworth, CA), and first strand synthesis was performed with reverse transcriptase, 30 ul of RNA, and reverse primer 147R (5' ATTCACCCACCAGCTCAGC 3'), chosen based on the conserved equine TCRβ 3' constant region (47). A homopolymeric tail was added at the 5' end with dCTP and terminal deoxytransferase followed by size fractionation to remove smaller cDNAs, and PCR with primer 74R (5' TCGGTGCGGGAGATCTCTGC 3') and the Abridged Anchor Primer from the 5' RACE System.…”

A Particular TCR β Variable Region Used by T Cells Infiltrating Kidney Transplants

“…Fragmentary information has also been gathered on the V␤ sequences of cows (18), rabbits (19), horses (20), and primates (21). Together with the human and rodent V␤ sequences, this set of porcine sequences represents one of the largest collections of V␤ segments described so far.…”