Characterization of recombinant human lysosomal beta-hexosaminidases produced in the methylotrophic yeast Pichia pastoris

Abstract

<em>β</em>-hexosaminidases (Hex) are dimeric enzymes involved in the lysosomal degradation of glycolipids and glycans. They are formed by <em>α</em>- and/or <em>β</em>-subunits encoded by HEXA and HEXB genes, respectively. Mutations in these genes lead to Tay Sachs or Sandhoff diseases, which are neurodegenerative disorders caused by the accumulation of non-degraded glycolipids. Although tissue-derived Hex have been widely characterized, limited information is available for recombinant <em>β</em>-hexosaminidases. In this study, human lysosomal recombinant Hex (rhHex-A, rhHex-B, and rhHex-S) were produced in the methylotrophic yeast <em>Pichia pastoris</em> <em>GS115</em>. The highest specific enzyme activities were 13,124 for rhHexA; 12,779 for rhHex-B; and 14.606 U.mg-1 for rhHex-S. These results were 25- to 50-fold higher than those obtained from normal human leukocytes. Proteins were purified and characterized at different pH and temperature conditions. All proteins were stable at acidic pH, and at<br />4 °C and 37 °C. At 45 °C rhHex-S was completely inactivated, while rhHex-A and rhHex-B showed high stability. This study demonstrates <em>P. pastoris GS115</em> potential for polymeric lysosomal enzyme production, and describes the characterization of recombinant <em>β</em>-hexosaminidases produced within the same host.

Production and characterization of a human lysosomal recombinant iduronate‐2‐sulfatase produced inPichia pastoris

“…A marked reduction in activity was observed at lower pH values (<35% of the activity at pH 6.0), whereas at pH 7.0 and 8.0, the enzyme activity ranged between 58% and 31% of activity observed at pH 6.0. Similar results were previously reported for human liver IDS, depending of the substrate , as well as for other lysosomal recombinant enzymes produced in P. pastoris .…”

“…The Mut phenotype of P. pastoris clones was screened by culturing the clones in MM plates [1.34% (w/v) yeast nitrogen base, 4 × 10 −5 % (w/v) biotin, and 0.5% (v/v) methanol] following the manufacturer's instructions (Thermo Fisher Scientific). Phenotype was also confirmed by PCR using the primers FW: 5′‐GACTGGTTCCAATTGACAAGC‐3′ and RW: 5′‐GCAAATGGCATTCTGACATCC‐3′, as previously reported . The strains P. pastoris GS115/His + /Mut s /HSA and P. pastoris GS115/His + /Mut + /B‐Gal (Thermo Fisher Scientific) were used as Mut s and Mut + controls, respectively.…”

“…Screening of the P. pastoris clones was done at 10 and 100 mL . Clones were grown in the YPD medium [yeast extract 1% (w/v); peptone 2% (w/v); dextrose 2% (w/v)] during 48 H at 28 °C and 250 rpm.…”

“…The cellular uptake of the prIDS was assayed in HEK 293 cells (CLR1573; ATCC, Manassas, VA, USA), as previously described . The cells were cultivated in Dulbecco's modified medium (Gibco, Carlsbad, CA, USA), supplemented with fetal bovine serum 15% (v/v), penicillin 100 U mL −1 , and streptomycin 100 U mL −1 , at 37 °C in a CO 2 incubator.…”

“…As an alternative to the production in mammalian cells, a growing number of studies have shown the possibility to produce active and therapeutic forms of lysosomal proteins in microorganisms . For instance, we have reported the production of active forms of human rIDS and N ‐acetylgalactosamine‐6‐sulfate sulfatase (GALNS) and β‐hexosaminidase A, B, and S in E. coli and/or P. pastoris . Furthermore, recombinant α‐glucosidase , α‐galactosidase A , GALNS , and lysosomal acid lipase produced in yeasts have shown successful cellular uptake both in cellular and animal models, and the reduction of the storage material.…”