Characterization of salicylic acid-induced genes in Chinese cabbage

Ys, Park; Hj, Min; Sh, Ryang; Kj, Oh; Cha, Jae‐Soon; Hy, Kim; Tj, Cho

doi:10.1007/s00299-003-0606-9

Cited by 20 publications

(17 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Samples from the EF-1α gene fragment amplifi cations, using the subtracted and unsubtracted cDNA pools, were analyzed after 15, 20, 25 and 30 cycles of PCR (Pokalsky et al, 1989). Primers used to amplify regions without an RsaI site were designed for one stress-induced gene, the pathogen-inducible PR4 gene: Chi3 F: 5'GTTTCCAGGTTTTGGTACTGCTGGT3' and Chi3 R: 5'CCACAATACCTCCTGTAAAATCCA A3'; these were used to test the subtraction effi ciency of the corresponding libraries before cloning.…”

Section: Methodsmentioning

confidence: 99%

“…bras., Brasília, v.43, n.8, p.1017-1023, ago. 2008 of a wide variety of defense molecules, such as antimicrobial proteins (Park et al, 2003;Shah, 2003;Ros et al, 2004). Defense responses are induced in pathogenesis-related situations, observed after the application of chemical substances, which simulate the effect of pathogen infection (e.g.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Differential gene expression, induced by salicylic acid and Fusarium oxysporum f. sp. lycopersici infection, in tomato

Amaral

Lima

Resende

et al. 2008

Pesq. agropec. bras.

View full text Add to dashboard Cite

-The objective of this work was to determine the transcript profi le of tomato plants (Lycopersicon esculentum Mill.), during Fusarium oxysporum f. sp. lycopersici infection and after foliar application of salicylic acid. The suppression subtractive hybridization (SSH) technique was used to generate a cDNA library enriched for transcripts differentially expressed. A total of 307 clones was identifi ed in two subtractive libraries, which allowed the isolation of several defense-related genes that play roles in different mechanisms of plant resistance to phytopathogens. Genes with unknown roles were also isolated from the two libraries, which indicates the possibility of identifying new genes not yet reported in studies of stress/defense response. The SSH technique is effective for identifi cation of resistance genes activated by salicylic acid and F. oxysporum f. sp. lycopersici infection. Not only the application of this technique enables a cost effective isolation of differentially expressed sequences, but also it allows the identifi cation of novel sequences in tomato from a relative small number of sequences.Index terms: Lycopersicon esculentum, cDNA libraries, complementary DNA, gene expression, salicylic acids, suppression subtractive hybridization. Expressão diferencial de genes induzida por ácido salicílico e por Fusarium oxysporum f. sp. lycopersici, em tomateiroResumo -O objetivo deste trabalho foi determinar o perfi l de transcritos em plantas de tomate (Lycopersicon esculentum Mill.), durante a infecção com Fusarium oxysporum f. sp. lycopersici e após a aplicação foliar de ácido salicílico. A técnica de hibridização subtrativa por supressão (SSH) foi utilizada para gerar uma biblioteca de cDNA enriquecida por transcritos diferencialmente expressos. Foram identifi cados 307 clones, em duas bibliotecas subtrativas, que permitiram o isolamento de diversos genes de defesa com função em diferentes processos relacionados à resistência vegetal contra patógenos. Também foram isolados, nas duas bibliotecas, genes com função desconhecida, o que indica a possibilidade de identifi cação de novos genes que ainda não tenham sido relatados em estudos anteriores de resposta a estresses e defesa, em plantas. A técnica SSH é efi ciente em identifi car genes de resistência, ativados pelo ácido salicílico e pela infecção com Fusarium oxysporum f. sp. lycopersici. A aplicação dessa técnica não apenas possibilita isolar seqüências diferencialmente expressas, a baixo custo, como também permite a identifi cação de novas seqüências, em tomate, a partir de um número relativamente pequeno de seqüências.Termos para indexação: Lycopersicon esculentum, bibliotecas de cDNA, DNA complementar, expressão gênica, ácido salicílico, hibridização subtrativa por supressão.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Differential gene expression, induced by salicylic acid and Fusarium oxysporum f. sp. lycopersici infection, in tomato

Amaral

Lima

Resende

et al. 2008

Pesq. agropec. bras.

View full text Add to dashboard Cite

show abstract

“…Previously, we isolated a partial cDNA clone that contained a Chinese cabbage thiJ-like gene exhibiting strong induction by salicylic acid and a pathogen (Park et al, 2003). Here, we report the cDNA sequence of the full coding region and more…”

Section: Introductionmentioning

confidence: 99%

Molecular Characterization of a thiJ-like Gene in Chinese Cabbage

Park²,

Lee³

et al. 2004

BMB Reports

View full text Add to dashboard Cite

A cDNA clone for a salicylic acid-induced gene in Chinese cabbage (Brassica rapa subsp. pekinensis) was isolated and characterized. The cabbage gene encoding a protein of 392 amino acids contained a tandem array of two thiJ-like sequences. ThiJ is a thiamin biosynthesis enzyme that catalyzes the phosphorylation of hydroxymethylpyrimidine (HMP) to HMP monophosphate. Although the cabbage gene shows a similarity to bacterial thiJ genes, it also shares a similarity with the human DJ-1, a multifunctional protein that is involved in transcription regulation, male fertility, and parkinsonism. The cabbage thiJ-like gene is strongly induced by salicylic acid and a nonhost pathogen, Pseudomonas syringae pv. tomato, which elicits a hypersensitive response in Chinese cabbage. Treatment of the cabbage leaves with BTH, methyl jasmonate, or ethephon showed that the cabbage thiJ-like gene expression is also strongly induced by BTH, but not by methyl jasmonate or ethylene. This indicates that the cabbage gene is activated via a salicylic acid-dependent signaling pathway. Examination of the tissue-specific expression revealed that the induction of the cabbage gene expression by BTH occurs in the leaf, stem, and floral tissues but not in the root.

show abstract

“…Rice plant seedlings were also grown under normal conditions to serve as controls for northern blotting. For salicylic acid-treated plants, healthy leaves were cut into 3-cm lengths and floated on 20 mM MOPS (pH 7.5) containing 5 mM salicylic acid in a petri dish for 0, 1, 4, 8, 12 or 24 h. (Park et al 2003). For benzyladenine (BA) treatment (Yamaryo et al 2003), we used 100 lM BA as mentioned above.…”

Section: Preparation Of Plant Materialsmentioning

confidence: 99%

“…For benzyladenine (BA) treatment (Yamaryo et al 2003), we used 100 lM BA as mentioned above. For methyl jasmonate (Me-JA) treatment, we used 1 mM Me-JA in 0.1% (v/v) ethanol for 24 h (Park et al 2003). The healthy rice leaves grown under different conditions were harvested, frozen in liquid nitrogen and stored at -80°C.…”

Section: Preparation Of Plant Materialsmentioning

confidence: 99%

Identification and cloning of a submergence-induced gene OsGGT (glycogenin glucosyltransferase) from rice (Oryza sativa L.) by suppression subtractive hybridization

Kawano

Yamauchi

et al. 2005

Planta

View full text Add to dashboard Cite

A submergence-induced gene, OsGGT, was cloned from 7-day submerged rice (Oryza sativa L. plants, FR13A (a submergence-tolerant cultivar, Indica), using suppression subtractive hybridization and both 5'- and 3'-rapid amplification of cDNA ends (RACE). The full-length OsGGT cDNA contains 1,273 bp with an open reading frame of 1,140 bp (17-1,156) that encodes 379 amino acids. Its deduced amino acid sequence is homologous with glycogenin glucosyltransferase. We found that the OsGGT gene is located in the 17,970-20,077 bp region of genome fragment AAAA01002475.1 of the Indica cultivar and in the 53,293-51,186 bp region of genome fragment AC037426.12 of chromosome 10 of the Japanica cultivar. A time-course study showed that OsGGT-gene expression increased in FR13A during submergence but decreased in IR42 (submergence-intolerant cultivar, Indica). The expression of the OsGGT gene in FR13A was induced by salicylic acid and benzyladenine. The accumulation of OsGGT mRNA in FR13A also increased in response to ethylene, gibberellin, abscisic acid, drought and salt treatment, but methyl jasmonate treatment and cold stress had no effect on expression. These results suggest that the OsGGT gene could be related to submergence stress and associated with a general defensive response to various environmental stresses.

show abstract

Characterization of salicylic acid-induced genes in Chinese cabbage

Cited by 20 publications

References 39 publications

Differential gene expression, induced by salicylic acid and Fusarium oxysporum f. sp. lycopersici infection, in tomato

Differential gene expression, induced by salicylic acid and Fusarium oxysporum f. sp. lycopersici infection, in tomato

Molecular Characterization of a thiJ-like Gene in Chinese Cabbage

Identification and cloning of a submergence-induced gene OsGGT (glycogenin glucosyltransferase) from rice (Oryza sativa L.) by suppression subtractive hybridization

Contact Info

Product

Resources

About