Characterization of the DGAT1 Mutations and the CSN1S1 Promoter in the German Angeln Dairy Cattle Population

Sanders, K.; Bennewitz, Jörn; Reinsch, Norbert; Thaller, Georg; Prinzenberg, E.-M.; Kuhn, C; Kalm, E.

doi:10.3168/jds.s0022-0302(06)72590-5

Cited by 50 publications

(67 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In the association analysis carried out without air temperature taken into account, the DGAT1:K232 allele significantly decreased milk and protein yields and increased fat yield and fat and protein contents (data not shown). These results are consistent with the findings of many previous studies performed in several dairy cattle populations (e.g., 6,8,13). To the best of the authors' knowledge, the influence of weather conditions on DGAT1 effects on milk yield and composition has not been investigated to date, although Duchemin et al (14) found significant K232A genotype by season interactions for some fatty acid contents in milk.…”

Section: Short Communicationsupporting

confidence: 82%

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

Komisarek¹,

Kolenda²

2016

Turk J Vet Anim Sci

View full text Add to dashboard Cite

Heat stress is a growing problem in dairy cattle breeding because of global warming and because of the genetic selection for greater production that reduces thermotolerance in cows. The negative influence of elevated environmental temperatures on economically important traits is well recognized in cattle. Thermal stress is responsible for decreased milk yield, milk fat, and protein contents, as well as reduced dry matter intake, health, and fertility (1,2). According to Gorniak et al. (2), even mild heat stress in cows kept in a temperate climate negatively affects milk production. Moreover, the decline in performance they observed could not be explained solely by reduced feed intake, and other factors, including changes in energy metabolism, might have contributed to decreased milk yield (2). At the physiological level, a hot environment was shown to induce several adaptive responses, including alterations of lipid metabolism (3).Acyl-coenzyme A:diacylglycerol transferase (DGAT1) is a lipogenic enzyme that plays a key role in the synthesis of triacylglycerols (4). An ApA to GpC dinucleotide substitution located in exon 8 of the bovine DGAT1 gene that replaces lysine (K) by alanine (A) in encoded protein (K232A polymorphism) has been proven to have a pronounced influence on milk yield and composition, especially on fat percentage in milk (5-7). Although in many cattle populations DGAT1:p.K232A alleles affected individual milk traits in the same direction, the magnitude of effects was variable between breeds (8), and during lactation (9). Recently, Akbar et al. (10) reported that the expression of this gene in the liver is reduced during the hot season. However, the impact of seasonal ambient air temperature changes on DGAT1 polymorphism effects is not known so far. The aim of this study was, therefore, to establish if the influence of K232A on milk production traits is dependent on environmental thermal conditions.The analyzed data set comprised 468 dairy cows of the Polish Holstein-Friesian (HF) breed, born between 1999 and 2002, and kept on the same farm under uniform environmental conditions. The animals were daughters of 109 sires, with the sire half-sib family sizes varying between 1 and 53. The average cow's milk yield per 305day lactation was 7452 kg.DNA for molecular analyses was extracted from peripheral blood using the standard phenol method. The biological material was collected in accordance with the ethical standards of the Local Ethics Committee for Animal Research. Genotypes of DGAT1:p.K232A were determined using the PCR-RFLP method, as described by Szyda and Komisarek (11), with the use of the following primers (5'-3'): F:TGCCGCTTGCTCGTAGCTTTGGCC* and

show abstract

Section: Short Communicationsupporting

confidence: 82%

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

Komisarek¹,

Kolenda²

2016

Turk J Vet Anim Sci

View full text Add to dashboard Cite

show abstract

“…The regression analysis of the DGAT1 promoter VNTR alleles revealed significant effects for the allele 5 enhancing the milk fat content percentage as well as the milk protein percentage but decreasing the milk yield and milk protein yield (Kuhn et al 2004). Sanders et al (2006) reported 6 alleles found in the DGAT1 promoter VNTR in the Angeln population, which were denoted as VNTR alleles A, B, C, D, E, and F, respectively. The allele F was present in two unrelated daughters only.…”

Section: Introductionmentioning

confidence: 95%

“…The DGAT1 gene encodes the DGAT1 enzyme, which catalyzes the final step of triglyceride synthesis (Sanders et al 2006).…”

Section: Introductionmentioning

confidence: 99%

Effect of DGAT1 polymorphisms on the estimated breeding values of Czech Simmental sires

Hanusová¹,

Mikova²,

Večerek³

et al. 2014

CZECH J ANIM SCI

View full text Add to dashboard Cite

ABSTRACT:The aim was to evaluate the effect of polymorphisms in the promoter and in the coding region of the DGAT1 gene on the estimated breeding values (EBV) of Czech Simmental sires. The K232A polymorphism (n = 191) in the coding region was genotyped by PCR/RFLP, and the KU and SA polymorphisms in the promoter (n = 203) were identified in an automatic sequencer. In the K232A polymorphism, the frequency of the genotype AA (Alanine) was greater than that of the genotype KA, the homozygous genotype KK (Lysine) was not found. Similarly, the allele A predominated over the K allele (0.945 and 0.055). The EBV for milk performance have been assigned to the genotypes, and the associations quantified. For the AA genotype and A allele, positive association with EBV of milk yield and protein yield was found, and negative association with the breeding values of fat percentage and yield, and protein percentage, but only the value of fat content was found to be significant. The positive non-significant association of the A variant with the protein yield was caused by the high milk yield. In the KU polymorphism, the CC genotype was associated significantly with lower EBV for the fat percentage, both the C allele and the CC genotype were associated with higher EBV for milk yield, so both the fat and the protein yield were non-significantly increased. For the diplotypes K232A/KU, there was a significant association with the fat percentage. The AACC combination seemed to have some breeding potential. The K232A polymorphism explained maximum of 6.2% of EBV variability, the KU polymorphism of 4.4%, and the SA polymorphism of 4.2%. The diplotypes K232A/KU explained maximum of 7.4% of variability. The highest proportion of variability was explained for fat percentage. The results confirmed the important role of the BTA14 region in controlling milk performance.

show abstract

“…Variable number of tandem repeat (VNTR) polymorphisms in the promoter region of the DGAT1 gene also seem to affect milk production traits, probably due to variation at the transcriptional level of the gene . A specific allele of the DGAT1 promoter VNTR showed significant effects on lactose yield and content and on milk energy content, compared with the other alleles (Sanders et al, 2006). DGAT1 and TG gene physically maps to the centromeric region of bovine chromosome 14 (Coppieters et al, 1998;Winter et al, 2002).…”

mentioning

confidence: 99%

Effect of DGAT1 and TG gene polymorphisms on intramuscular fat and on milk production traits in different cattle breeds in Hungary

Anton¹,

Kovács²,

Fésüs³

et al. 2008

Acta Veterinaria Hungarica

View full text Add to dashboard Cite

The objective of this study was to estimate the effect of the thyroglobulin (TG) locus on beef quality traits in some beef cattle breeds and to investigate the effect of the DGAT1 locus on milk production traits in the Hungarian Holstein Friesian population. TG and DGAT1 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. At the TG locus TT bulls showed the highest fat percentage values in the longissimus dorsi muscle (m. longissimus dorsi); the difference between CC and TT genotypes was significant. DGAT1 GC/GC cows had the highest milk, fat and protein yield values. Due to the relatively small number of GC/GC cows the difference proved to be significant only between AA/AA and AA/GC genotypes.

show abstract

Characterization of the DGAT1 Mutations and the CSN1S1 Promoter in the German Angeln Dairy Cattle Population

Cited by 50 publications

References 23 publications

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

Effect of DGAT1 polymorphisms on the estimated breeding values of Czech Simmental sires

Effect of DGAT1 and TG gene polymorphisms on intramuscular fat and on milk production traits in different cattle breeds in Hungary

Contact Info

Product

Resources

About