Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies

Abstract

Objectives: The ovarian tumor marker CA125 is expressed on human MUC16, a cell surface bound mucin that is also shed by proteolytic cleavage. Human MUC16 is overexpressed by ovarian cancer cells. MUC16 facilitates the binding of ovarian tumor cells to mesothelial cells lining the peritoneal cavity. Additionally, MUC16 also is a potent inhibitor of natural killer cell mediated anti-tumor cytotoxic responses. Extensive studies using human as well as murine ovarian tumor cell models are required to clearly define the function of MUC16 in the progression of ovarian tumors. The major objective of this study was to determine if the murine ovarian tumor cells, MOVCAR, express Muc16 and to characterize antibodies that recognize this mucin. Methods:RT-PCR analysis was used for detecting the Muc16 message and size exclusion column chromatography for isolating Muc16 produced by MOVCAR cells. Soluble and cell-associated murine Muc16 were analyzed, respectively, by Western blotting and flow cytometry assays using a new panel of antibodies. The presence of N-linked oligosaccharides on murine Muc16 was determined by ConA chromatography. Results:We demonstrate that murine Muc16 is expressed by mouse ovarian cancer cells as an ~250 kDa glycoprotein that carries both O-linked and N-linked oligosaccharides. In contrast to human MUC16, the murine ortholog is primarily released from the cells and cannot be detected on the cell surface. Since the released murine Muc16 is not detected by conventional anti-CA125 assays, we have for the first time identified a panel of anti-human MUC16 antibodies that also recognizes the murine counterpart. Conclusion:The antibodies identified in this study can be used in future purification of murine Muc16 and exhaustive study of its properties. Furthermore, the initial identification and characterization of murine Muc16 is a vital preliminary step in the development of effective murine models of human ovarian cancer. These models will aid in the further elucidation of the role that human MUC16 plays in the etiology and progression of ovarian tumors.

The Mucin MUC16 (CA125) Binds to NK Cells and Monocytes from Peripheral Blood of Women with Healthy Pregnancy and Preeclampsia

“…The RNA was reverse transcribed into cDNA using Omniscript RT kit from Qiagen (Cat.No.205111). The MUC16 and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) were amplified with the respective primers (MUC16 forward: 5′GCCTCTACCTTAACGGTTACAATGAA3′; reverse: 5′GGTACCCCATGGCTGTTGTG-3:, and GAPDH forward: GAGTCAACGGATTTGGTCGT, reverse: TTGATTTTGGAGGGATCTCG) using fast cycling PCR kit from Qiagen as described in our earlier studies 12, 24 . MUC 16 was amplified using the initial activation for 10 minutes at 95°C, followed by 35 cycles of 15 seconds at 95°C and 1 minute at 60°C.…”

Genetically engineered mucin mouse models for inflammation and cancer

“…Both of them are expressed by the ovarian surface epithelial cells, though their cellular localization is different. Human MUC16 is present on the cell surface and soluble fraction due to its shedding from the cell membrane, whereas murine Muc16 has shown to be secreted by MOVCAR ovarian cells [37]. …”

Mining the Immune Cell Proteome to Identify Ovarian Cancer-Specific Biomarkers

“…The MUC16 and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) were amplified with the respective primers (MUC16 forward: 5′GCCTCTACCTTAACGGTTACAATGAA3′, reverse: 5′GGTACCCCATGGCTGTTGTG-3′; and GAPDH forward: GAGTCAACGGATTTGGTCGT, reverse: TTGA TTTTGGAGGGATCTCG) using fast cycling PCR kit from Qiagen as described in our earlier studies. 12,24 MUC 16 was amplified using the initial activation for 10 min at 95°C, followed by 35 cycles of 15 s at 95°C and 1 min at 60°C. The cycling conditions used for amplifying GAPDH were, initial activation at 95°C for 5min, followed by 30 cycles of the denaturation at 96°C for 5 s, annealing at 60°C for 5 s and extension at 68°C for 10 s, with final extension at 72°C for 1 min.…”