CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation

Abstract

One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

CHD7 and 53BP1 regulate distinct pathways for the re-ligation of DNA double-strand breaks

“…siCHD7-1-resistant CHD7 cDNA was generated by introducing the underlined mutations: GAAAATAAGGATAGCGAAAAG by polymerase chain reaction (PCR) and cloned as NotI/XmaI fragment into pCDNA3.1-FLAG-His-mCherry-CHD7-WT and pCDNA3.1-FLAG-His-mCherry-CHD7-K998R (Table 2) pmCherry-macroH2A1.1 25 and cloned as an XmaI/BglII fragment into piRFP670-C3 to generate piRFP670-mH2A1.1. All other plasmids were described previously: pPAGFP-H2A 24 , pmEGFP-ALC1, pPTagRFP-H2B 23 , piRFP670-ALC1 wildtype (WT), piRFP670-ALC1 ATPase-dead (E175Q), pLacI-GFP trap 22 , pYFP-mH2A1.1 macro domain 57 , and pPARP1-mCherry 58 .…”

“…Fluorescence three-hybrid assay. Florescence three-hybrid assays were performed as described 22 . Briefly, GFP-tagged proteins were tethered to a genomically integrated LacO array using a LacI-GFP trap in U2OS-2B2 cells 56 expressing mCherry-PARP1.…”

Studying DNA Double-Strand Break Repair: An Ever-Growing Toolbox

“…This approach can also be complemented with FRAP and FLIP studies (see Mortusewicz and Leonhardt, 2007). The use of fluorescentlytagged histone proteins allowed the study of chromatin dynamics following damage with great resolution (Burgess et al, 2014;Luijsterburg et al, 2016;Sellou et al, 2016;Smith et al, 2018). Finally, this method has been useful to investigate the release of factors from DSBs and the post-translational modifications (PTMs) that drive such dynamics.…”

CHD4 is essential for transcriptional repression and lineage progression in B lymphopoiesis

“…Thus, CHD4-NuRD has been revealed as an integral driver of appropriate transcription during cell type specification. Complementing its roles in CHD4-NuRD complexes, CHD4’s ability to be recruited independently of NuRD enables additional functions in DNA damage repair and cell cycle progression (29–33), signal transduction (34), and overall genome maintenance (35).…”