Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae)

Abstract

The coding region of the mat K gene and two intergenic spacers, psb A-trn H and trn L(UAA)-trn F(GAA), of cpDNA were sequenced to study phylogenetic relationships of 32 Paeonia species. In the psb A-trn H intergenic spacer, short sequences bordered by long inverted repeats have undergone inversions that are often homoplasious mutations. Insertions/deletions found in the two intergenic spacers, mostly resulting from slipped-strand mispairing, provided relatively reliable phylogenetic information. The mat K coding region, evolving more rapidly than the trnL-trn F spacer and more slowly than the psb A-trn H spacer, produced the best resolved phylogenetic tree. The mat K phylogeny was compared with the phylogeny obtained from sequences of internal transcribed spacers (ITS) of nuclear ribosomal DNA. A refined hypothesis of species phylogeny of section Paeonia was proposed by considering the discordance between the nuclear and cpDNA phylogenies to be results of hybrid speciation followed by inheritance of cpDNA of one parent and fixation of ITS sequences of another parent. The Eurasian and western North American disjunct distribution of the genus may have resulted from interrruption of the continuous distribution of ancestral populations of extant peony species across the Bering land bridge during the Miocene. Pleistocene glaciation may have played an important role in triggering extensive reticulate evolution within section Paeonia and shifting distributional ranges of both parental and hybrid species.

Evolutionary events in Lilium (including Nomocharis, Liliaceae) are temporally correlated with orogenies of the Q–T plateau and the Hengduan Mountains

“…Second, the coalescence of organelle DNA may be four times faster than in nuclear genes (Moore, 1995). Some reports suggest that ITS evolves much faster than chloroplast DNA, but the cases are few and have been recognized as special ones (Buckler and Holtsford, 1996;Sang et al, 1997). Therefore, it is unlikely that lineage sorting of nuclear genes had been completed before the divergences of the incongruent clades from their common ancestor, while polymorphisms in chloroplast genes were retained in their common ancestors.…”

Phylogeny and biogeographic diversification of Maianthemum (Ruscaceae: Polygonatae)

“…rps16: primers F and R2 (Oxelman et al, 1997; Andersson and Nova,1999); psbA-trnH: primers psbA and trnH (Sang et al, 1997;Hamilton, 1999); rpl16: primers rpl16_F and R (Asmussen, 1999); ndhF: primers 15F and 2110R or 2070R (Olmstead et al, 1994;Oxelman et al, 1999;Bremer et al, 2002); trnK: primers trnK_685F (GTATCGCACTATGTATGATTTGA) and 2R (AACTAGTCGGATGGAGTAG) are modified from Lavin et al (2000) and an internal primer trnK_ maiR (GACTTGAAAGATAACCCAGAA) was designed for sequencing; ITS: primers MF (5' TCGAGACCCGAACGGACRAT 3') and MR (GTGCTCGGCATGGGTTCCTT), which were designed in this study based on the ITS sequences of Maianthemum racemosum from GenBank (U23982 and U24041). When amplification of the ITS region was unsuccessful, two internal primers ITS2 and ITS3 (White et al, 1990) were used in the following combinations: MF and ITS2, and ITS3 and MR to obtain PCR products in two shorter fragments.…”

“…rps16: primers F and R2 (Oxelman et al, 1997;Andersson and Nova,1999); psbA-trnH: primers psbA and trnH (Sang et al, 1997;Hamilton, 1999); rpl16: primers rpl16_F and R (Asmussen, 1999); ndhF:…”

Hybridization, polyploidy, and evolutionary transitions between monoecy and dioecy in Bryonia (Cucurbitaceae)

“…However, diffi culties in species identifi cation in Bryonia might also be an artifact because herbarium material may not show features, such as fruit color and stigma pubescence, that are important species characters in this genus ( Jeffrey, 1969 ). Molecular sequences can be a powerful tool to assign individuals to natural gene pools and to identify hybrid individuals, provided that within-species sampling is suffi ciently dense and that the nuclear and organelle loci chosen evolve at suitable speeds ( Rieseberg and Wendel, 1993 ;Sang et al, 1997 ).…”

“…For example, dioecy appears to break down in polyploid populations of Empetrum : The diploid E. nigrum var. The trnL intron and trnL-trnF intergenic spacer (IGS) were amplifi ed using the Taberlet et al, (1991) primers c, d, e, and f, and an annealing temperature of 55 ° C. The psbA-trnH spacer was amplifi ed at the same annealing temperature with the forward primer of Sang et al (1997) and the trnH 2 reverse primer 5 ′ CGCGCATGGTGGATTCACAATCC 3 ′ (developed by C. Heibl). The trnRatpA spacer was amplifi ed with the forward and reverse primers of Chung et al (2003) .…”