Chronic phosphodiesterase type 5 inhibition has beneficial effects on subcutaneous adipose tissue plasticity in type 2 diabetic mice

Fiore, Daniela; Gianfrilli, Daniele; Cardarelli, Silvia; Naro, Fabio; Lenzi, Andrea; Isidori, Andrea M.; Venneri, Mary Anna

doi:10.1002/jcp.26796

Cited by 9 publications

(6 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These findings were then confirm in T2DM patients where 3 months of oral sildenafil (100 mg/day) reduced the endothelial function marker P‐selectin 49 . In pre‐clinical, as well as in clinical studies using chronic PDE5i with sildenafil 100 mg daily, we and others have shown that the NO‐cGMP‐PDE5 pathway and related targets are involved in the pathogenesis of several complications of diabetes affecting the immune system, 46‐48 adipose tissue, 50,51 and renal function 39 . A dose of 50mg of Sildenafil, given twice a week, was shown to improve surrogate markers of endothelial function (C‐reactive protein, endothelin‐1 and ICAM‐1, ANG‐1/TIE2 axis), modulating the number of circulating proangiogenic cells and exerting an anti‐inflammatory response in T2Dm patients 52 …”

Section: Introductionsupporting

confidence: 64%

“…[46][47][48] These findings were then confirm in T2DM patients where 3 months of oral sildenafil (100 mg/day) reduced the endothelial function marker P-selectin. 49 In pre-clinical, as well as in clinical studies using chronic PDE5i with sildenafil 100 mg daily, we and others have shown that the NO-cGMP-PDE5 pathway and related targets are involved in the pathogenesis of several complications of diabetes affecting the immune system, [46][47][48] adipose tissue, 50,51 and renal function. Its expression in men 53 is even higher, making them more responsive to PDE5i, as revealed in pulmonary hypertension (PH) and fibrosis.…”

Section: Introductionmentioning

confidence: 95%

See 1 more Smart Citation

Targeting the NO‐cGMP‐PDE5 pathway in COVID‐19 infection. The DEDALO project

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background A pandemic outbreak of COVID‐19 has been sweeping the world since December. It begins as a respiratory infection that, mainly in men with diabetes or renal impairment, evolves into a systemic disease, with SARDS, progressive endothelial cell damage, abnormal clotting and impaired cardiovascular and liver function. Some clinical trials are testing biological drugs to limit the immune system dysregulation, “cytokines storm,” that causes the systemic complications of COVID‐19. The contraindications of these drugs and their cost raise concerns over the implications of their widespread availability. Objectives Numerous clinical and experimental studies have revealed a role for the nitric oxide (NO)‐cyclic GMP‐phosphodiesterase type 5 (PDE5) pathway in modulating low‐grade inflammation in patients with metabolic diseases, offering cardiovascular protection. PDE5 inhibition favors an anti‐inflammatory response by modulating activated T cells, reducing cytokine release, lowering fibrosis, increasing oxygen diffusion, stimulating vascular repair. PDE5 is highly expressed in the lungs, where its inhibition improves pulmonary fibrosis, a complication of severe COVID‐19 disease. Materials and methods We performed a systematic review of all evidence documenting any involvement of the NO‐cGMP‐PDE5 axis in the pathophysiology of COVID‐19, presenting the ongoing clinical trials aimed at modulating this axis, including our own “silDEnafil administration in DiAbetic and dysmetaboLic patients with COVID‐19 (DEDALO trial).” Results The reviewed evidence suggests that PDE5 inhibitors could offer a new strategy in managing COVID‐19 by (i) counteracting the Ang‐II‐mediated downregulation of AT‐1 receptor; (ii) acting on monocyte switching, thus reducing pro‐inflammatory cytokines, interstitial infiltration and the vessel damage responsible for alveolar hemorrhage‐necrosis; (iii) inhibiting the transition of endothelial and smooth muscle cells to mesenchymal cells in the pulmonary artery, preventing clotting and thrombotic complications. Discussion and Conclusion If the ongoing trials presented herein should provide positive findings, the low cost, wide availability and temperature stability of PDE5 inhibitors could make them a major resource to combat COVID‐19 in developing countries.

show abstract

Section: Introductionsupporting

confidence: 64%

Section: Introductionmentioning

confidence: 95%

Targeting the NO‐cGMP‐PDE5 pathway in COVID‐19 infection. The DEDALO project

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…In this context, PDE5i treatment was indeed associated with a significant reduction of albuminuria and glycated hemoglobin (HbA1c) [60]. It is worth noticed that, some years later, a meta-analysis on the effect of PDE5i on glycemic control in T2DM concluded that PDE5i had no beneficial effect on HbA1c [61], similar results were obtained in diabetic mice, where the authors did not observed changes in blood glucose or insulin levels upon chronic inhibition of PDE5 [62].…”

Section: Endothelial Dysfunction and Inflammationmentioning

confidence: 69%

“…In db/db mice, sildenafil induced an overall reduction in AT, mainly in visceral AT (VAT) associated with a reduction in cytokines expression. Stromal vascular fraction (SVF) of subcutaneous adipose tissue (SAT) showed an increase in the frequency of anti-inflammatory M2 macrophages and endothelial cells in treated mice that leads to an improvement of SAT homeostasis and distribution [62] confirming an interconnection between inflammation and endothelium.…”

Section: Endothelial Dysfunction and Inflammationmentioning

confidence: 93%

PDE5 Inhibitors in Type 2 Diabetes Cardiovascular Complications

et al. 2020

Self Cite

View full text Add to dashboard Cite

Pharmacological inhibition of Phosphodiesterase type 5 (PDE5) proved its efficacy treating several pathological conditions, such as erectile dysfunction and pulmonary hypertension. Nowadays, its benefits on cardiovascular diseases are well documented, particularly in the treatment of type 2 diabetes (T2DM)-related cardiovascular complications. In this context, treatment of T2DM with PDE5 inhibitors, such as sildenafil, tadalafil or vardenafil ameliorates endothelial dysfunction both in patients and animal models through an augmented flow mediated dilation rate and an up-regulation of endothelial markers; it also reduces the inflammatory state by down-regulating inflammatory cytokines expression and improves diabetic cardiomyopathy and ischemia-reperfusion injury mainly through the activation of NO-cGMP-PKG pathway. The present review summarizes the state of art on PDE5 inhibition in the treatment of cardiovascular complications in T2DM.

show abstract

“…GCTTGGTCTTGAATGAAGTCA, successfully demonstrated that udenafil suppresses TLR4 mRNA expression in the hypothalamus [9]. Another study conducted by Fiore et al (2018) with sequence forward: GGAGGAGAATACTGGCAAGA, reverse: GATGCATGGTAAGACAGGAC; in type 2 diabetic mice administrated sildenafil for 12 weeks could increase adipogenesis and improve adipose tissue [10]. The amplification of PDE5 gene depends not only on the primers determined, but it also depends on other factors such as dNTP, PCR templates, number of cycles, polymerase enzymes, and technical and non-technical effects [11].…”

Section: Introductionmentioning

confidence: 97%

The Analysis of Primer Gene of Phosphodiesterase Type 5 (PDE5) on Erectyle Dysfungction

Watuguly¹,

Samsuria²,

Astuti³

et al. 2018

OJAppS

View full text Add to dashboard Cite

Backround: Erectile dysfunction (ED) is the inability of male reproductive organs within sexual intercourse caused by neurogenic and hormonal disorders. There are some causes of ED such as hypertension, stress, neurological disorders, stroke, diabetes, atherosclerosis, lifestyle, alcohol, smoking, and age-related hormonal decline can cause infertility. The natural treatment of sexual dysfunction through aphrodisiac activity of the plant is to increase sexual hormones, spermatogenesis activity and through PDE5 inhibitors such as sildenafil, verdenafil, and tadalafil which can inhibit the hydrolysis of second messenger cGMP of penis smooth muscle cells. Primer Design for amplification of several PDE5 gene nucleotide sequences obtained from NCBI gen banks and tested directly through explosions at NCBI and also using MEGA 6, primer 3 plus, and fast PCR software. The natural treatment of sexual dysfunction through aphrodisiac activity from plants to increase sexual hormone, spermatogenesis activity and inhibitor PDE5 such as sildenafil, vardenafil, and tadalafil can inhibit hydrolysis second messenger of cells cGMP smooth penis muscles. Method: Primer design stages for several sequences are data supply, multiple sequence alignment, sequence trimming, primer design (fastPCR input), in silico PCR analysis, and primer evaluation (Primer Test, OligoCalc and BLAST). Results: Primer of PDE5 that is choosen is with reverse sequence 5-TGCATTGACCATGTCTCTCGTT-3, forward 5-CGCCGATCTGGGCTGAACTA-3 able to amplify template DNA at temperature 67.2˚C, 65.8˚C, 63.7˚C, however, the DNA band fragment looks not very clear, while it is more clearly seen at Tm temperature 61.2˚C, 59.1˚C, 57.8˚C and 57˚C. Conclusion:

show abstract

Chronic phosphodiesterase type 5 inhibition has beneficial effects on subcutaneous adipose tissue plasticity in type 2 diabetic mice

Cited by 9 publications

References 22 publications

Targeting the NO‐cGMP‐PDE5 pathway in COVID‐19 infection. The DEDALO project

Targeting the NO‐cGMP‐PDE5 pathway in COVID‐19 infection. The DEDALO project

PDE5 Inhibitors in Type 2 Diabetes Cardiovascular Complications

The Analysis of Primer Gene of Phosphodiesterase Type 5 (PDE5) on Erectyle Dysfungction

Contact Info

Product

Resources

About