Chronological and Biological Age Predict Seasonal Reproductive Timing: An Investigation of Clutch Initiation and Telomeres in Birds of Known Age

Bauer, Carolyn M.; Graham, Jessica Lynn; Āboliņš-Ābols, Mikus; Heidinger, Britt J.; Ketterson, Ellen D.; Greives, Timothy J.

doi:10.1086/697224

Cited by 22 publications

(27 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, this trend is not consistent amongst all birds, with some species showing increases in TRF with age, as in the Leach's storm‐petrel ( Oceanodroma leucorhoa ) (Haussmann et al, ), and no decline in length, or both as reported for the Magellanic penguin ( Spheniscus magellanicus ) (Cerchiara et al, ). For individuals in some avian species, change in telomere length can be tracked longitudinally and correlate with reproductive timing; however, the use of TRF for cross‐sectional analysis of age has yet to be demonstrated (Bauer et al, ).…”

Section: Discussionmentioning

confidence: 99%

Age estimation in a long‐lived seabird (Ardenna tenuirostris) using DNA methylation‐based biomarkers

Paoli-Iseppi

Deagle

Polanowski

et al. 2019

Molecular Ecology Resources

View full text Add to dashboard Cite

Age structure is a fundamental aspect of animal population biology. Age is strongly related to individual physiological condition, reproductive potential and mortality rate. Currently, there are no robust molecular methods for age estimation in birds. Instead, individuals must be ringed as chicks to establish known‐age populations, which is a labour‐intensive and expensive process. The estimation of chronological age using DNA methylation (DNAm) is emerging as a robust approach in mammals including humans, mice and some non‐model species. Here, we quantified DNAm in whole blood samples from a total of 71 known‐age Short‐tailed shearwaters (Ardenna tenuirostris) using digital restriction enzyme analysis of methylation (DREAM). The DREAM method measures DNAm levels at thousands of CpG dinucleotides throughout the genome. We identified seven CpG sites with DNAm levels that correlated with age. A model based on these relationships estimated age with a mean difference of 2.8 years to known age, based on validation estimates from models created by repeated sampling of training and validation data subsets. Longitudinal observation of individuals re‐sampled over 1 or 2 years generally showed an increase in estimated age (6/7 cases). For the first time, we have shown that epigenetic changes with age can be detected in a wild bird. This approach should be of broad interest to researchers studying age biomarkers in non‐model species and will allow identification of markers that can be assessed using targeted techniques for accurate age estimation in large population studies.

show abstract

Section: Discussionmentioning

confidence: 99%

Age estimation in a long‐lived seabird (Ardenna tenuirostris) using DNA methylation‐based biomarkers

Paoli-Iseppi

Deagle

Polanowski

et al. 2019

Molecular Ecology Resources

View full text Add to dashboard Cite

show abstract

“…Quantitative PCR (qPCR) was used to measure relative telomere length in extracted samples with respect to a single‐copy control gene (glyceraldehyde‐3‐phosphate dehydrogenase, GAPDH ) (Criscuolo et al, ), following methods adapted for the dark‐eyed Junco (Bauer et al, ). GAPDH primer sequences were as follows: forward GAPDH (5’‐AACCAGCCAAGTACGATGACAT‐3′) and reverse GAPDH (5′‐CCATCAGCAGCAGCCTTCA‐3′).…”

Section: Methodsmentioning

confidence: 99%

“…A standard curve (40, 20, 10, 5 and 2.5 ng) from a single reference sample was run in triplicate on every plate to control for interplate variation (Schmidt et al, ). These values were chosen because they consistently produce reactions with optimal efficiencies (Bauer et al, ; Schmidt et al, ). The curve was made by mixing red blood cell samples from six one‐year‐old male dark‐eyed juncos and extracting DNA from the pooled sample four times.…”

Section: Methodsmentioning

confidence: 99%

“…All C t values fell within the range of the standard curve. The ratio of number of telomere repeats (TTAGGG) to the number of copies of GAPDH (or T/S ratio) was used to quantify relative telomere length using the formula: T/S ratio = 2 ‐ΔΔCt , where ΔΔC t = (C t telomere – C t GAPDH ) reference – (C t telomere – C t GAPDH ) focal (Bauer et al, ; Cawthon, ). The 20 ng dilution reference sample from the standard curve was used to calculate the T/S ratio (as the reference C t value in the calculation).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Early‐breeding females experience greater telomere loss

et al. 2019

Self Cite

View full text Add to dashboard Cite

Annual reproductive success is often highest in individuals that initiate breeding early, yet relatively few individuals start breeding during this apparently optimal time. This suggests that individuals, particularly females who ultimately dictate when offspring are born, incur costs by initiating reproduction early in the season. We hypothesized that increases in the ageing rate of somatic cells may be one such cost. Telomeres, the repetitive DNA sequences on the ends of chromosomes, may be good proxies of biological wear and tear as they shorten with age and in response to stress. Using historical data from a long‐term study population of dark‐eyed juncos (Junco hyemalis), we found that telomere loss between years was greater in earlier breeding females, regardless of chronological age. There was no relationship between telomere loss and the annual number of eggs laid or chicks that reached independence. However, telomere loss was greater when temperatures were cooler, and cooler temperatures generally occur early in the season. This suggests that environmental conditions could be the primary cause of accelerated telomere loss in early breeders.

show abstract

“…A possible reason that early-47 life conditions have often been observed to influence the functioning of the adult stress response may be 48 that early-life conditions can speed up or slow down the biological ageing process, and consequently 49 advance or retard age-related shifts in the functioning of the stress response system. A potential marker of 50 biological age is the attrition of telomeres, the DNA caps at the ends of linear chromosomes (Bize et al, 51 2009;Bauer et al, 2018), with more lifetime attrition indicating greater biological age. The rate of 52 telomere attrition is much higher during the developmental period than in adulthood, and has been shown 53 to be accelerated by early-life adversity (Boonekamp et al, 2014;Nettle et al, 2015 Nettle et al, , 2017.…”

mentioning

confidence: 99%

Chronological age, biological age, and individual variation in the stress response in the European starling: A follow-up study

Gott

Andrews

Hormigos

et al. 2018

Preprint

View full text Add to dashboard Cite

The responsiveness of the avian stress system declines with age. A recently published study of European starlings (Sturnus vulgaris) found that a marker of biological age predicted stress responsiveness even in individuals of the same chronological age.Specifically, birds that had experienced greater developmental telomere attrition showed a lower peak corticosterone response to an acute stressor, and more rapid recovery of corticosterone levels towards baseline. Here, we performed a follow-up study using the same capture-restraint-handling stressor in a separate cohort of 27 starlings. Unlike the original study, we measured the response at two different age points (4 and 18 months).We did not replicate the associations with developmental telomere attrition observed in the previous study at either age point. However, a meta-analysis of the present results combined with those of the earlier study still lent some support to the conclusions of the earlier paper. Estimates of familial influence on stress responsiveness differed across the two age points. We found little evidence of individual consistency in stress responsiveness between 4 and 18 months. Peak corticosterone was significantly lower at the second age point than the first, though interpretation of this as age-related decline is problematic due to the samples having been analysed at different times. found that a marker of biological age predicted stress responsiveness even in 21 individuals of the same chronological age. Specifically, birds that had experienced greater developmental 22 telomere attrition showed a lower peak corticosterone response to an acute stressor, and more rapid 23 recovery of corticosterone levels towards baseline. Here, we performed a follow-up study using the same 24 capture-restraint-handling stressor in a separate cohort of 27 starlings. Unlike the original study, we 25 measured the response at two different age points (4 and 18 months). We did not replicate the associations 26 with developmental telomere attrition observed in the previous study at either age point. However, a 27 meta-analysis of the present results combined with those of the earlier study still lent some support to the 28 conclusions of the earlier paper. Estimates of familial influence on stress responsiveness differed across 29 the two age points. We found little evidence of individual consistency in stress responsiveness between 4 30 and 18 months. Peak corticosterone was significantly lower at the second age point than the first, though 31 interpretation of this as age-related decline is problematic due to the samples having been analysed at 32 different times. , 2015). Biological age is by definition a better predictor of future lifespan than 45 chronological age is. Hence, we should expect markers of individual biological age to explain variation in 46 stress responsiveness that cannot be explained by chronological age alone. A possible reason that early-47 life conditions have often been observed to influence the functioning of the adult stress respon...

show abstract

Chronological and Biological Age Predict Seasonal Reproductive Timing: An Investigation of Clutch Initiation and Telomeres in Birds of Known Age

Cited by 22 publications

References 49 publications

Age estimation in a long‐lived seabird (Ardenna tenuirostris) using DNA methylation‐based biomarkers

Age estimation in a long‐lived seabird (Ardenna tenuirostris) using DNA methylation‐based biomarkers

Early‐breeding females experience greater telomere loss

Chronological age, biological age, and individual variation in the stress response in the European starling: A follow-up study

Contact Info

Product

Resources

About