Cinobufacin Suppresses Cell Proliferation via miR-494 in BGC-823 Gastric Cancer Cells

Zhou, Ranran; Chen, Gang; Shen, Zhili; Pan, L.L.

doi:10.7314/apjcp.2014.15.3.1241

Cited by 28 publications

(22 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The reaction was run in 20 ml that included 50 ng of cDNA and 0.3 nM of the corresponding primers. The U6 and mir-494 primers sequences were obtained from Zhou et al 30 For U6 forward primer sequence was ATTGGAACGA-TACAGAGAAGATT and the reverse was GGAACGCTTCAC-GAATTTG. For mir-494, the forward primer sequence was TGACCTGAAACATACACGGGA while the reverse was TATCGTTGTACTCCACTCCTTGAC.…”

Section: Rt-pcrmentioning

confidence: 99%

Epigenetics and miRNA as predictive markers and targets for lung cancer chemotherapy

El‐Awady

Hersi

Al-Tunaiji

et al. 2015

Cancer Biology & Therapy

View full text Add to dashboard Cite

Abbreviations: 5AZA, 5-aza-2 0 -deoxycytidine; BSA, bovine serum albumin; DMSO, dimethyl sulfoxide; DNMT, DNA methyltransferase; HAT, histone acetyl transferase; HDAC, histone deacetylase; NSCLC, non-small cell lung cancer; PBS, phosphate-buffered saline; SCLC, small-cell lung cancer; TSA, trichostatin A; 5mc, 5-methyl cytosine.Lung cancer cells show inherent and acquired resistance to chemotherapy. The lack of good predictive markers/ novel targets and the incomplete understanding of the mechanisms of resistance limit the success of lung cancer response to chemotherapy. In the present study, we used an isogenic pair of lung adenocarcinoma cell lines; A549 (wild-type) and A549DOX11 (doxorubicin resistant) to study the role of epigenetics and miRNA in resistance/response of non-small cell lung cancer (NSCLC) cells to doxorubicin. Our results demonstrate differential expression of epigenetic markers whereby the level of HDACs 1, 2, 3 and4, DNA methyltransferase, acetylated H2B and acetylated H3 were lower in A549DOX11 compared to A549 cells. Fourteen miRNAs were dys-regulated in A549DOX11 cells compared to A549 cells, of these 14 miRNAs, 4 (has-mir-1973, 494, 4286 and 29b-3p) have shown 2.99 -4.44 fold increase in their expression. This was associated with reduced apoptosis and higher resistance of A549DOX11cells to doxorubicin and etoposide. Sequential treatment with the epigenetic modifiers trichostatin A or 5-aza-2'-deoxycytidine followed by doxorubicin resulted in: (i) enhanced sensitivity of both cell lines to doxorubicin especially at low concentrations, (ii) enhanced doxorubicin-induced DNA damage in both cell lines, (iii) dysregulation of some miRNAs in A549 cells. In conclusion, A549DOX11 cells resistant to DNA damaging drugs have epigenetic profile and miRNA expression different from the sensitive cells. Moreover, epigenetic modifiers may reverse the resistance of certain NSCLC cells to DNA damaging agents by enhancing induction of DNA damage. This may open the door for using epigenetic profile/miRNA expression of some cancer cells as resistance markers/targets to improve response of resistant cells to doxorubicin and for the use of combination doxorubicin/epigenetic modifiers to reduce doxorubicin toxicity.

show abstract

Section: Rt-pcrmentioning

confidence: 99%

Epigenetics and miRNA as predictive markers and targets for lung cancer chemotherapy

El‐Awady

Hersi

Al-Tunaiji

et al. 2015

Cancer Biology & Therapy

View full text Add to dashboard Cite

show abstract

“…In addition, miR-143 expression was identified to be significantly decreased in cervical cancer, and associated with tumor size, positive lymph node metastasis and HPV16 infection (10). A previous study demonstrated that the expression level of miR-145 was significantly decreased in human cervical cancer miR-494 inhibits cervical cancer cell proliferation through upregulation of SOCS6 expression LEI CHENG 1,2 , BEIHUA KONG 1 , YING ZHAO 2 and JIE JIANG tissues when compared with corresponding adjacent normal tissues and associated with tumor progression, and poor prognosis (11). Furthermore, miR-494 serves as a tumor suppressor miRNA and abnormal expression of miR-494 has been identified in a number of tumor tissue types (8,9).…”

Section: Introductionmentioning

confidence: 99%

miR-494 inhibits cervical cancer cell proliferation through upregulation of SOCS6 expression

et al. 2017

View full text Add to dashboard Cite

Abstract. It is unclear how microRNA (miR)-494 inhibits the proliferation of cervical cancer cells by altering the expression of SOCS6. Therefore, the present study aimed to investigate the molecular mechanism underlying miR-494 regulation of suppressor of cytokine signaling 6 (SOCS6) in human cervical cancer samples and the human cervical cancer HeLa cell line. The expression of miR-494 was determined using reverse transcription-quantitative polymerase chain reaction. In addition, TargetScan was used to predict miR-494 target genes and the luciferase reporter assay was used to determine whether SOCS6 was a direct target of miR-494. The results of the present study demonstrated that compared with the cervical intraepithelial neoplasia and normal cervical tissues, the miR-494 expression level in cervical cancer samples was significantly decreased (P<0.01). In addition, compared with normal cervical tissue, miR-494 expression level was significantly decreased in cervical intraepithelial lesions (P<0.05). Furthermore, the expression of miR-494 was associated with patients with or without lymph node metastasis, clinical stage and depth of stromal invasion (P<0.01); however, miR-494 expression was not identified to be associated with age, tumor size and menopausal status (P>0.05). Transfection of a miR-494 mimic significantly increased the expression level of miR-494 in HeLa cells (P<0.01), and anti-miR-494 transfection decreased the expression of miR-494 (P<0.01). An MTT proliferation assay and Boyden chamber invasion ability assay revealed that miR-494 mimic transfection significantly inhibited the proliferation, and invasion ability of HeLa cells (P<0.01), whereas anti-miR-494 transfection significantly increased the proliferation and invasion ability (P<0.05). SOCS6 was predicted, using bioinformatics, to be the target gene of miR-494 and this was validated using a luciferase reporter assay. Western blot analysis revealed that transfection of miR-494 significantly increased the expression of SOCS6 in HeLa cells, and transfection of anti-miR-494 significantly decreased the expression of SOCS6. Therefore, the results of the present study demonstrated that miR-494 expression in cervical cancer was significantly decreased. Exhibiting a decreased expression level of miR-494 may result in enhanced proliferative and invasive abilities of HeLa cell, thus contributing to the occurrence, and development of cervical cancer. IntroductionCervical cancer is the second most common type of female malignancy, subsequent to breast cancer. There were an estimated 527,600 new cervical cancer cases and 265,700 deaths worldwide in 2012 (1). Although cervical cytology screening has enabled early detection and early treatment of cervical cancer, the incidence and mortality rates continue to increase each year (2,3). The majority of patients with cervical cancer are treated with standard radiation therapy and chemotherapy, but therapeutic response varies. Thus, studies are required to determine the pathogenesis of cervical cancer in orde...

show abstract

“…So far it is the fourth most frequently diagnosed cancer as each year more than one million patients are annually diagnosed with gastric cancer (Ferlay et al, 2010;Hernandez et al, 2010;Basiri et al, 2014;Behnampour et al, 2014;Calik et al, 2014;Deng et al, 2014;Khoshbaten et al, 2014;Karim et al, 2014;Lu et al, 2014;Unal et al, 2014;Yang et al, 2014;Zhou et al, 2014). The incidence of stomach cancer varies geographically, with a much higher prevalence in Eastern countries than in the Western ones .…”

Section: Introductionmentioning

confidence: 99%

Anti-Proliferation Effects and Molecular Mechanisms of Action of Tetramethypyrazine on Human SGC-7901 Gastric Carcinoma Cells

Ji¹,

Liu²,

Ju³

et al. 2014

Asian Pacific Journal of Cancer Prevention

View full text Add to dashboard Cite

Cinobufacin Suppresses Cell Proliferation via miR-494 in BGC-823 Gastric Cancer Cells

Cited by 28 publications

References 24 publications

Epigenetics and miRNA as predictive markers and targets for lung cancer chemotherapy

Epigenetics and miRNA as predictive markers and targets for lung cancer chemotherapy

miR-494 inhibits cervical cancer cell proliferation through upregulation of SOCS6 expression

Anti-Proliferation Effects and Molecular Mechanisms of Action of Tetramethypyrazine on Human SGC-7901 Gastric Carcinoma Cells

Contact Info

Product

Resources

About