CIP2A Inhibits PP2A in Human Malignancies

Abstract

Inhibition of protein phosphatase 2A (PP2A) activity has been identified as a prerequisite for the transformation of human cells. However, the molecular mechanisms by which PP2A activity is inhibited in human cancers are currently unclear. In this study, we describe a cellular inhibitor of PP2A with oncogenic activity. The protein, designated Cancerous Inhibitor of PP2A (CIP2A), interacts directly with the oncogenic transcription factor c-Myc, inhibits PP2A activity toward c-Myc serine 62 (S62), and thereby prevents c-Myc proteolytic degradation. In addition to its function in c-Myc stabilization, CIP2A promotes anchorage-independent cell growth and in vivo tumor formation. The oncogenic activity of CIP2A is demonstrated by transformation of human cells by overexpression of CIP2A. Importantly, CIP2A is overexpressed in two common human malignancies, head and neck squamous cell carcinoma (HNSCC) and colon cancer. Thus, our data show that CIP2A is a human oncoprotein that inhibits PP2A and stabilizes c-Myc in human malignancies.

LB100, a small molecule inhibitor of PP2A with potent chemo- and radio-sensitizing potential

“…45 The endogenous protein, cancerous inhibitor of PP2A (CIP2A), indirectly inhibits PP2A through binding c-Myc and preventing its ubiquitation by PP2A-mediated dephosphorylation at key residues. 46,47 As such, overexpression of CIP2A has been demonstrated in numerous human malignancies, consistent with a role for PP2A as a tumor suppressor. 41,48,49 …”

PP2A holoenzyme assembly: in cauda venenum (the sting is in the tail)

“…Hence, PP2A deregulation can result in several pathological conditions such as cancer [3][4][5][6][7] and Alzheimer's disease (AD) [1,2]. Moreover, several viruses use PP2A to deregulate cellular pathways in the host [1][2][3]8], underscoring the general importance of PP2A in signal transduction.…”

“…In vivo Tyr307 phosphorylation has been observed in several conditions: in Box 3. Stoichiometric balance and PP2A-subunit composition in cancer PP2A has a central role in protecting cells against tumorigenic transformation, and both the a and b isoforms of human A subunits have been identified as tumor suppressors [1][2][3][4][5][6][7]. Although mutations in PPP2R1B, which encodes Ab, are more common, mutations in PPP2R1A, which encodes Aa, occur at low frequency in human tumors.…”

Identification of a c-Jun N-terminal kinase-2-dependent signal amplification cascade that regulates c-Myc levels in ras transformation

“…The pLuc-1850 and pLuc1850m is from S Kitajima (Cai et al, 2000). c-Myc and CIP2A pB puro (Junttila et al, 2007) and JNK2 pB puro (Dietrich et al, 2004) constructs are described in co-publications. For the ATF2 and c-Myc short hairpin constructs the corresponding primers ATF2 (forward: 5 0 -GATCCCCCAATGGTGATAC TGTAAAATTCAAGAGATTTTACAGTATCACCATTGTT TTTGGAAA-3 0 and reverse: 5 0 -AGCTTTTCCAAAAACA ATGGTGATACTGTAAAATCTCTTGAATTTTACAGTAT CACCATTGGGG-3 0 ) and c-Myc (forward: 5 0 -GATCCCCA GGTAGTGATCCTCAAAAATTCAAGAGATTTTTGAGG ATCACTACCTTTTTTGGAAA-3 0 and reverse: 5 0 -AGCTT TTCCAAAAAAGGTAGTGATCCTCAAAAATCTCTTGA ATTTTTGAGGATCACTACCTGGG-3 0 ) were cloned into pRetro-puro vector as described elsewhere (Nielsen et al, 2007).…”

“…Phosphorylation of c-Myc induced by ERK and/or JNK on c-Myc Ser 62 protects c-Myc from proteasomal degradation (Sears et al, 1999(Sears et al, , 2000Alarcon-Vargas and Ronai, 2004). This site is actively dephosphorylated by protein phosphatase 2A (PP2A) in non-cancerous cells, but on oncogenic stimulation becomes protected by cancerous inhibitor of PP2A (CIP2A), whose expression thereby stabilizes c-Myc (Junttila et al, 2007;Come et al, 2009;Khanna et al, 2009). How oncogenic activation increases CIP2A levels over the threshold that is needed for the stabilization of c-Myc is still poorly understood.…”