Clinical and molecular aspects of the live attenuated Oka varicella vaccine

Quinlivan, Mark; Breuer, Judith

doi:10.1002/rmv.1789

Cited by 30 publications

(28 citation statements)

References 158 publications

(286 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A recent study using deep sequencing identified 165 additional nucleotide changes in VOka, although most changes were presence in <10% of viral genomes (7). Attenuation of VOka is postulated to be due to mutations in multiple regions of the genome (8,9).…”

mentioning

confidence: 99%

In vitro system using human neurons demonstrates that varicella-zoster vaccine virus is impaired for reactivation, but not latency

Sadaoka

Depledge

Rajbhandari

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

104

View full text Add to dashboard Cite

Varicella-zoster virus (VZV) establishes latency in human sensory and cranial nerve ganglia during primary infection (varicella), and the virus can reactivate and cause zoster after primary infection. The mechanism of how the virus establishes and maintains latency and how it reactivates is poorly understood, largely due to the lack of robust models. We found that axonal infection of neurons derived from hESCs in a microfluidic device with cell-free parental Oka (POka) VZV resulted in latent infection with inability to detect several viral mRNAs by reverse transcriptase-quantitative PCR, no production of infectious virus, and maintenance of the viral DNA genome in endless configuration, consistent with an episome configuration. With deep sequencing, however, multiple viral mRNAs were detected. Treatment of the latently infected neurons with Ab to NGF resulted in production of infectious virus in about 25% of the latently infected cultures. Axonal infection of neurons with vaccine Oka (VOka) VZV resulted in a latent infection similar to infection with POka; however, in contrast to POka, VOka-infected neurons were markedly impaired for reactivation after treatment with Ab to NGF. In addition, viral transcription was markedly reduced in neurons latently infected with VOka compared with POka. Our in vitro system recapitulates both VZV latency and reactivation in vivo and may be used to study viral vaccines for their ability to establish latency and reactivate. varicella-zoster virus | varicella vaccine | reactivation | latency | herpesvirus V aricella-zoster virus (VZV) is a member of Alphaherpesvirinae, characterized by neurotropism and lifelong latent infection in human dorsal root, cranial nerve, and enteric ganglia (1). During primary infection (varicella), VZV gains access to sensory neurons by two potential routes: retrograde axonal transport from cutaneous lesions or infection of neurons by virus-infected T cells circulating through the body (2). The virus then establishes latency in neurons, and months to years later, when VZV-specific T cells decline, the virus can reactivate to cause herpes zoster.VZV is the only human herpesvirus for which a licensed vaccine is approved, and the live-attenuated vaccine Oka (VOka) virus is effective in preventing both varicella and zoster. VOka was derived from WT parental Oka (POka) by propagation in human embryonic lung cells, guinea pig embryo fibroblasts, and human fibroblasts (3, 4). VOka is a genetic mixture of at least eight genotypes (5), and, initially, the genomes of POka and VOka were found to differ by 42 nucleotides and 20 amino acids (6). A recent study using deep sequencing identified 165 additional nucleotide changes in VOka, although most changes were presence in <10% of viral genomes (7). Attenuation of VOka is postulated to be due to mutations in multiple regions of the genome (8, 9).Despite numerous studies, the mechanisms for establishment and maintenance of VZV latency and subsequent reactivation remain poorly understood, primarily due to the lack of ...

show abstract

mentioning

confidence: 99%

In vitro system using human neurons demonstrates that varicella-zoster vaccine virus is impaired for reactivation, but not latency

Sadaoka

Depledge

Rajbhandari

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

104

View full text Add to dashboard Cite

show abstract

“…Life-threatening disseminated disease can occur in severely immunosuppressed patients. HZ complications include postherpetic neuralgia, HZ ophthalmicus, stroke and meningoencephalitis 1. The zoster vaccine has been shown to be effective in preventing both zoster and postherpetic neuralgia.…”

Section: Discussionmentioning

confidence: 99%

“…VZV Oka (vOka) vaccine strain was detected in vesicle fluid, using a real-time PCR assay that targets single nucleotide polymorphism (SNP) 108111 in a 174 bp region of open reading frame 62. SNP 108111 has been shown to differentiate VZV vaccine and wild-type sequences 1 2. Briefly, reactions consisted of 0.7 µM each primer (VZV-F, 5′ CGAAACAAACTCACGACTCTT; VZV-R, 5′GATACCCGCCCAAGGAAA) and 1.4 µM each probe (WT-Pr, 5′JOE–TTTcTCcACtGGgCTGTCA; Oka-Pr, 5′FAM–TTTcTCcAC c GGgCTGTCA, where DNA nucleotides are denoted in upper case, LNA nucleotides in lower case and the ocked nucleic acid (LNA) nucleotide complementary to SNP 108111 is underlined), Quantifast Multiplex PCR mastermix (Qiagen), 5 µL purified DNA and water to make a 25 µL reaction volume.…”

Section: Investigationsmentioning

confidence: 99%

Fatal disseminated varicella zoster infection following zoster vaccination in an immunocompromised patient

et al. 2016

View full text Add to dashboard Cite

A 79-year-old man with chronic lymphocytic leukaemia presented with fever and a widespread vesicular rash on 19 November 2014. The patient had not been under immunosuppressive regime for 6 months. He had received a shingles vaccine on 14th October and developed flu-like symptoms after 2 weeks. Intravenous antimicrobial therapy including aciclovir was started. He remained stable with no evidence of systemic involvement. On day 5, he developed respiratory and renal failure that required transfer to intensive care unit. Vesicle fluid, bronchoalveolar lavage and plasma were positive for varicella zoster virus by PCR. Slight clinical improvement allowed extubation on day 16. He subsequently deteriorated and died on day 25. Multiorgan failure was considered the immediate cause of death whereas disseminated varicella zoster infection was stated in the medical certificate as the other condition leading to this outcome. Varicella zoster Oka vaccine strain was detected in vesicle fluid, using PCR.

show abstract

“…However, no increased risk of serious adverse events including stroke, meningitis, encephalitis, or Bell’s palsy was seen within 42 days of vaccination [104]. Post-marketing surveillance has demonstrated the varicella vaccine is also well tolerated, with the vaccine linked to only a handful of cases of VZV neurological disease and single case of fatal varicella [105]. …”

Section: Post-marketing Surveillance Of Live-attenuated Varicella Andmentioning

confidence: 99%

Varicella and herpes zoster vaccine development: lessons learned

Warren‐Gash

Forbes

Breuer

2017

Expert Review of Vaccines

View full text Add to dashboard Cite

Introduction: Before vaccination, varicella zoster virus (VZV), which is endemic worldwide, led to almost universal infection. This neurotropic virus persists lifelong by establishing latency in sensory ganglia, where its reactivation is controlled by VZV-specific T-cell immunity. Lifetime risk of VZV reactivation (zoster) is around 30%. Vaccine development was galvanised by the economic and societal burden of VZV, including debilitating zoster complications that largely affect older individuals. Areas covered: We describe the story of development, licensing and implementation of live attenuated vaccines against varicella and zoster. We consider the complex backdrop of VZV virology, pathogenesis and immune responses in the absence of suitable animal models and examine the changing epidemiology of VZV disease. We review the vaccines’ efficacy, safety, effectiveness and coverage using evidence from trials, observational studies from large routine health datasets and clinical post-marketing surveillance studies and outline newer developments in subunit and inactivated vaccines. Expert commentary: Safe and effective, varicella and zoster vaccines have already made major inroads into reducing the burden of VZV disease globally. As these live vaccines have the potential to reactivate and cause clinical disease, developing alternatives that do not establish latency is an attractive prospect but will require better understanding of latency mechanisms.

show abstract

Clinical and molecular aspects of the live attenuated Oka varicella vaccine

Cited by 30 publications

References 158 publications

In vitro system using human neurons demonstrates that varicella-zoster vaccine virus is impaired for reactivation, but not latency

In vitro system using human neurons demonstrates that varicella-zoster vaccine virus is impaired for reactivation, but not latency

Fatal disseminated varicella zoster infection following zoster vaccination in an immunocompromised patient

Varicella and herpes zoster vaccine development: lessons learned

Contact Info

Product

Resources

About