Clinical Evaluation of an In-House Reverse Transcription-Competitive PCR for Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma

Zazzi, Maurizio; Romanò, Laura; Catucci, Marinunzia; Venturi, Giulietta; Milito, Angelo De; Valensin, Pier Egisto

doi:10.1128/jcm.37.2.333-338.1999

“…Determination of HIV‐1 RNA load in plasma was performed by using the ultrasensitive HIV Amplicor Monitor test (Roche Molecular Systems, Branchburg, NJ, USA). In the seven patients who interrupted therapy HIV‐1 viraemia was measured by an in‐house competitive RT‐PCR as described elsewhere [34].…”

Section: Methodsmentioning

confidence: 99%

Plasma levels of soluble CD27: a simple marker to monitor immune activation during potent antiretroviral therapy in HIV-1-infected subjects

Milito

¹

,

Aleman

²

,

Marenzi

³

et al. 2002

Clinical and Experimental Immunology

View full text Add to dashboard Cite

SUMMARYPlasma levels of soluble CD27 (sCD27) are elevated in diseases characterized by T cell activation and are used as a marker of immune activation. We assessed the usefulness of determining plasma sCD27 as a marker for monitoring immune activation in HIV-1-infected patients treated with highly active antiretroviral therapy (HAART). A first cross-sectional examination of 68 HIV-1-infected and 18 normal subjects showed high levels of sCD27 in HIV-1 infection; plasma sCD27 was correlated to HIV-1 viraemia and inversely correlated to CD4 + T cell count. Twenty-six HIV-1-infected patients undergoing HAART were studied at baseline and after 6, 12, 18 and 24 months of therapy. Seven additional patients under HAART were analysed at baseline, during and after interruption of therapy. In the total population, HAART induced a significant and progressive reduction, but not a normalization, of plasma levels of sCD27 after 24 months. A full normalization of plasma sCD27 was observed in the virological responders (undetectable HIV-1 RNA at months 18 and 24) and also in patients with moderate immunodeficiency at baseline (CD4 + T cell count >200 cells/mm 3 ). Changes in plasma neopterin paralleled the changes in sCD27 but only baseline sCD27 levels were predictive of a greater increase in CD4 + T cell count during the follow-up. Discontinuation of therapy resulted in a rapid increase of sCD27 plasma levels associated with viraemia rebound and drop in CD4 + T cell count. Our findings suggest that plasma sCD27 may represent an alternative and simple marker to monitor immune activation during potent antiretroviral therapy. HIV-1-induced immune activation can be normalized by HAART in successfully treated patients where the disease is not advanced.

show abstract

“…HIV-1 DNA burden in peripheral blood mononuclear cells (PBMCs) and plasma HIV-1 RNA load were quantitated by competitive PCR and RT-PCR methods, respectively, as described [Zazzi et al, 1996;Zazzi et al, 1999]. The Nef-encoding proviral DNA region was amplified by nested PCR with outer primers NEF-1 (5Ј CAGTAGCTGAGGGGACAGATAG 3Ј, position 8693-8712 in the HIV-1 SF2 strain, GenBank accession number KO2007) and NEF-2 (5Ј CCACTCCCCAGTC-CCGCCC 3Ј; position 9481-9500) and inner primers NEF-3 (5Ј CATACCTAGAAGAATAAGACAGGG 3Ј; 8757-8380) and NEF-4 (5Ј CCCAGCGGAAAGTCCCT-TGTAG 3Ј; position 9436-9457) using 1 g of PBMC DNA as starting material.…”

Section: Methodsmentioning

confidence: 99%

Analysis of the HIV-1 nef gene in five intravenous drug users with long-term nonprogressive HIV-1 infection in Italy

Catucci

¹

,

Venturi

²

,

Romanò

³

et al. 2000

Self Cite

View full text Add to dashboard Cite

Great variability in the course of human immunodeficiency virus type 1 (HIV-1) infection results from a complex interplay between host and virus factors. Some of the patients with prolonged nonprogressive infection have been reported to harbor virus variants with gross deletions in the accessory nef gene that has been implicated in in vivo pathogenicity in simian and mouse models. To investigate the role of nef-deleted HIV-1 in long-term nonprogressor (LTNP) drug addicts in Italy the nef sequence from proviral DNA was analyzed from five LTNPs and five rapid progressor controls. Only small (2-12 amino acids) in-frame deletions and insertions were detected in the N-terminal polymorphic and variable regions obtained from three LTNPs and one rapid progressor. There was no evidence of premature termination of the Nef protein and all of the identified functional motifs were well conserved in both groups. Phylogenetic analysis showed interdigitation of nef sequences obtained from LTNPs and rapid progressors. The nef sequence of one LTNP, however, diverged significantly from those of the other patients. Availability of two additional blood DNA samples obtained previously from this subject allowed to detect evolution of nef at 14-17 years of HIV-1 infection, including progressive deletions. Although alterations of nef may be relatively frequent and continue to evolve in LTNPs, this study of a small number of patients does not indicate that gross deletions or loss of functional motifs play a major role in delaying or halting disease progression in infected drug abusers in Italy.

show abstract

Analysis of the HIV-1nef gene in five intravenous drug users with long-term nonprogressive HIV-1 infection in Italy

Catucci

¹

,

Venturi

²

,

Romanò

³

et al. 2000

View full text Add to dashboard Cite

Great variability in the course of human immunodeficiency virus type 1 (HIV-1) infection results from a complex interplay between host and virus factors. Some of the patients with prolonged nonprogressive infection have been reported to harbor virus variants with gross deletions in the accessory nef gene that has been implicated in in vivo pathogenicity in simian and mouse models. To investigate the role of nef-deleted HIV-1 in long-term nonprogressor (LTNP) drug addicts in Italy the nef sequence from proviral DNA was analyzed from five LTNPs and five rapid progressor controls. Only small (2-12 amino acids) in-frame deletions and insertions were detected in the N-terminal polymorphic and variable regions obtained from three LTNPs and one rapid progressor. There was no evidence of premature termination of the Nef protein and all of the identified functional motifs were well conserved in both groups. Phylogenetic analysis showed interdigitation of nef sequences obtained from LTNPs and rapid progressors. The nef sequence of one LTNP, however, diverged significantly from those of the other patients. Availability of two additional blood DNA samples obtained previously from this subject allowed to detect evolution of nef at 14-17 years of HIV-1 infection, including progressive deletions. Although alterations of nef may be relatively frequent and continue to evolve in LTNPs, this study of a small number of patients does not indicate that gross deletions or loss of functional motifs play a major role in delaying or halting disease progression in infected drug abusers in Italy.

show abstract

Clinical Evaluation of an In-House Reverse Transcription-Competitive PCR for Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma

Cited by 11 publications

References 26 publications

Plasma levels of soluble CD27: a simple marker to monitor immune activation during potent antiretroviral therapy in HIV-1-infected subjects

Plasma levels of soluble CD27: a simple marker to monitor immune activation during potent antiretroviral therapy in HIV-1-infected subjects

Analysis of the HIV-1 nef gene in five intravenous drug users with long-term nonprogressive HIV-1 infection in Italy

Analysis of the HIV-1nef gene in five intravenous drug users with long-term nonprogressive HIV-1 infection in Italy

Contact Info

Product

Resources

About