Clinical whole-exome sequencing for the diagnosis of rare disorders with congenital anomalies and/or intellectual disability: substantial interest of prospective annual reanalysis

Nambot, Sophie; Thévenon, Julien; Kuentz, Paul; Duffourd, Yannis; Tisserant, Émilie; Bruel, Ange‐Line; Mosca-Boidron, Anne-Laure; Masurel‐Paulet, Alice; Lehalle, Daphné; Jean-Marçais, Nolwenn; Lefebvre, Mathilde; Vabres, P.; Chehadeh-Djebbar, Salima El; Philippe, Christophe; Mau-Them, Frédéric Tran; St‐Onge, Judith; Jouan, Thibaud; Chevarin, Martin; Poé, Charlotte; Carmignac, Virginie; Vitobello, Antonio; Callier, Patrick; Rivière, Jean‐Baptiste; Faivre, Laurence; Thauvin‐Robinet, Christel

doi:10.1038/gim.2017.162

Cited by 161 publications

(153 citation statements)

References 43 publications

Supporting

Mentioning

143

Contrasting

Unclassified

Order By: Relevance

“…Additionally, two studies were published supporting the advantage of reanalysis. Nambot et al reported 15.4% definitive results after reanalyzing 156 initially reported negative cases. Half of these cases ( n = 12) were solved due to new publications that either implicate new causative genes or allowed reclassification of variants.…”

Section: Discussionmentioning

confidence: 99%

Reanalysis of exome sequencing data of intellectual disability samples: Yields and benefits

et al. 2018

View full text Add to dashboard Cite

Recently, with the advancement in next generation sequencing (NGS) along with the improvement of bioinformatics tools, whole exome sequencing (WES) has become the most efficient diagnostic test for patients with intellectual disability (ID). This study aims to estimate the yield of a reanalysis of ID negative exome cases after data reannotation. Total of 50 data files of exome sequencing, representing 50 samples were collected. The inclusion criteria include ID phenotype, and previous analysis indicated a negative result (no abnormality detected). These files were pre-processed and reannotated using ANNOVAR tool. Prioritized variants in the 50 cases studied were classified into three groups, (1) disease-causative variants (2) possible disease-causing variants and (3) variants in novel genes. Reanalysis resulted in the identification of pathogenic/likely pathogenic variants in six cases (12%). Thirteen cases (26%) were classified as having possible disease-causing variants. Candidate genes requiring future functional studies were detected in seven cases (14%). Improvement in bioinformatics tools, update in the genetic databases and literature, and patients' clinical phenotype update were the main reasons for identification of these variants in this study.

show abstract

Section: Discussionmentioning

confidence: 99%

Reanalysis of exome sequencing data of intellectual disability samples: Yields and benefits

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Of note, 11 cases classified as nondiagnostic in this study were ultimately clinically diagnosed with multiple system atrophy, cerebellar type, and another case was identified with a VUS associated with increased risk for this condition (Gilman et al, ; Zhao et al, ). We also reclassified variants from our previously reported 76 cases (Fogel et al, ) based on current annotation, which has been shown to improve diagnosis over time (Alfares et al, ; Ewans et al, ; Fogel, ; Fogel, Lee, Strom, Deignan, & Nelson, ; Fogel et al, ; Nambot et al, ; Rexach et al, ; Wright et al, ). This resulted in four cases previously classified as nondiagnostic or having a reportable VUS being reclassified with a pathogenic/likely pathogenic genetic variant.…”

Section: Discussionmentioning

confidence: 99%

A diagnostic ceiling for exome sequencing in cerebellar ataxia and related neurological disorders

et al. 2019

View full text Add to dashboard Cite

Genetic ataxias are associated with mutations in hundreds of genes with high phenotypic overlap complicating the clinical diagnosis. Whole-exome sequencing (WES) has increased the overall diagnostic rate considerably. However, the upper limit of this method remains ill-defined, hindering efforts to address the remaining diagnostic gap. To further assess the role of rare coding variation in ataxic disorders, we reanalyzed our previously published exome cohort of 76 predominantly adult and sporadic-onset patients, expanded the total number of cases to 260, and introduced analyses for copy number variation and repeat expansion in a representative subset.For new cases (n = 184), our resulting clinically relevant detection rate remained *Kathie J. Ngo and Jessica E. Rexach contributed equally to this work. ORCIDJennifer E. Posey http://orcid.org/0000-0003-4814-6765 James R. Lupski http://orcid.org/0000-0001-9907-9246 Brent L. Fogel http://orcid.org/0000-0001-9831-1576 SUPPORTING INFORMATION Additional supporting information may be found online in the Supporting Information section. How to cite this article: Ngo KJ, Rexach JE, Lee H, et al. A diagnostic ceiling for exome sequencing in cerebellar ataxia and related neurological disorders. Human Mutation. 2020; 41:487-501. https://doi.

show abstract

“…Genomic DNA was extracted from the buccal swab using a standard phenol‐chloroform procedure. Exome capture and sequencing and the resulting libraries were sequenced using the methods previously described in Nambot et al Complete exome sequencing (ES) section can be found in the Supporting Information and methods. The identified variant was validated by Sanger sequencing with forward 5′‐TGTTTCTGCCTTCCCCTCAT‐3′ and reverse 5′‐TGGGAAGCCTCAGGAAGAAG‐3′ polymerase chain reaction (PCR) primers.…”

Section: Methodsmentioning

confidence: 99%

Report of the first patient with a homozygous OTUD7A variant responsible for epileptic encephalopathy and related proteasome dysfunction

et al. 2020

Self Cite

View full text Add to dashboard Cite

Heterozygous microdeletions of chromosome 15q13.3 (MIM: 612001) show incomplete penetrance and are associated with a highly variable phenotype that may include intellectual disability, epilepsy, facial dysmorphism and digit anomalies. Rare patients carrying homozygous deletions show more severe phenotypes including epileptic encephalopathy, hypotonia and poor growth. For years, CHRNA7 (MIM: 118511), was considered the candidate gene that could account for this syndrome. However, recent studies in mouse models have shown that OTUD7A/CEZANNE2 (MIM: 612024), which encodes for an ovarian tumor (OTU) deubiquitinase, should be considered the critical gene responsible for brain dysfunction. In this study, a patient presenting with severe global developmental delay, language impairment and epileptic encephalopathy was referred to our genetics center. Trio exome sequencing (tES) analysis identified a homozygous OTUD7A missense variant (NM_130901.2:c.697C>T), predicted to alter an ultraconserved amino acid, p.(Leu233Phe), lying within the OTU catalytic domain. Its subsequent segregation analysis revealed that the parents, presenting with learning disability, and brother were heterozygous carriers. Biochemical assays demonstrated that proteasome complex formation and function were significantly reduced in patient‐derived fibroblasts and in OTUD7A knockout HAP1 cell line. We provide evidence that biallelic pathogenic OTUD7A variation is linked to early‐onset epileptic encephalopathy and proteasome dysfunction.

show abstract

Clinical whole-exome sequencing for the diagnosis of rare disorders with congenital anomalies and/or intellectual disability: substantial interest of prospective annual reanalysis

Cited by 161 publications

References 43 publications

Reanalysis of exome sequencing data of intellectual disability samples: Yields and benefits

Reanalysis of exome sequencing data of intellectual disability samples: Yields and benefits

A diagnostic ceiling for exome sequencing in cerebellar ataxia and related neurological disorders

Report of the first patient with a homozygous OTUD7A variant responsible for epileptic encephalopathy and related proteasome dysfunction

Contact Info

Product

Resources

About