Clonal expansion of mitochondrial DNA deletions is a private mechanism of aging in long‐lived animals

Abstract

Disruption of mitochondrial metabolism and loss of mitochondrial DNA (mtDNA) integrity are widely considered as evolutionarily conserved (public) mechanisms of aging (López‐Otín et al., Cell, 153, 2013 and 1194). Human aging is associated with loss in skeletal muscle mass and function (Sarcopenia), contributing significantly to morbidity and mortality. Muscle aging is associated with loss of mtDNA integrity. In humans, clonally expanded mtDNA deletions colocalize with sites of fiber breakage and atrophy in skeletal muscle. mtDNA deletions may therefore play an important, possibly causal role in sarcopenia. The nematode Caenorhabditis elegans also exhibits age‐dependent decline in mitochondrial function and a form of sarcopenia. However, it is unclear if mtDNA deletions play a role in C. elegans aging. Here, we report identification of 266 novel mtDNA deletions in aging nematodes. Analysis of the mtDNA mutation spectrum and quantification of mutation burden indicates that (a) mtDNA deletions in nematode are extremely rare, (b) there is no significant age‐dependent increase in mtDNA deletions, and (c) there is little evidence for clonal expansion driving mtDNA deletion dynamics. Thus, mtDNA deletions are unlikely to drive the age‐dependent functional decline commonly observed in C. elegans. Computational modeling of mtDNA dynamics in C. elegans indicates that the lifespan of short‐lived animals such as C. elegans is likely too short to allow for significant clonal expansion of mtDNA deletions. Together, these findings suggest that clonal expansion of mtDNA deletions is likely a private mechanism of aging predominantly relevant in long‐lived animals such as humans and rhesus monkey and possibly in rodents.

Mitochondrial Heterogeneity

“…Further downstream sources of mitochondrial heterogeneity, such as translation errors, have also been shown to have physiological consequences in budding yeast (Suhm et al, 2018). The age-related functional decline of mitochondria in shorter-lived animals (Itsara et al, 2014; Brandt et al, 2017) might not be explained directly by mtDNA mutations (Vermulst et al, 2007; Lakshmanan et al, 2018) (see also recent, contrasting, results in Drosophila ; Kauppila T.E. et al, 2018; Samstag et al, 2018).…”

“…Deletion mutations have been associated with local fiber atrophy and breakage in mice (Wanagat et al, 2001; Khrapko and Vijg, 2009) and rhesus monkeys (Aiken et al, 2002) (although the causative role of mtDNA mutations in aging for shorter-lived animals is contested; Vermulst et al, 2007; Kauppila T.E. et al, 2018; Lakshmanan et al, 2018). It is noteworthy that mitochondrial dysfunction in a particular tissue is able to induce stress responses in distal tissues through the mitochondrial unfolded protein response (Zhao et al, 2002; Durieux et al, 2011; Zhang et al, 2018) and other hormonal signaling pathways (Tyynismaa et al, 2010; Khan et al, 2017), suggesting potential organism-wide consequences of focal mitochondrial mutations.…”

Quantitative mitochondrial DNA copy number determination using droplet digital PCR with single-cell resolution

“…Over the course of an individual's lifespan, mtDNA mutations and deletions accumulate within cells and tissues; in some instances, mutant mtDNA propagates at an even faster rate than its wild-type counterparts (Trifunovic et al 2004;Lakshmanan et al 2018). It has been suggested that such age-related increases in mtDNA heteroplasmy may contribute to the onset and progression of various diseases (Cortopassi et al 1992;Chen et al 2011).…”

Mitochondria surveillance systems trigger innate immune responses to bacterial pathogens via AMPK pathway inC. elegans

“…MtDNA damage was assessed using Real Time-qPCR according to the published method. (Cristina et al, 2009;Lakshmanan et al, 2018) The pair of primers (Forward: GTTTATGCTGCTGTAGCGTG, Reverse: CTGTTAAAGCAAGTGGACGAG) were used to normalize the mitochondrial genome. The results were normalized to genomic DNA using primer pairs specific for ama-1(Forward: TGGAACTCTGGAGTCACACC, Reverse: CATCCTCCTTCATTGAACGG).…”