Cloning and analysis of calbindin-D28K cDNA and its expression in the central nervous system

Lomri, Noureddine; Gouhier, Nelly; Thomasset, M.

doi:10.1016/0378-1119(89)90253-9

Cited by 38 publications

(9 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Filters were prehybridised, then hybridised with 32 Plabelled cDNA for either rat intestinal calbindin-D 9K (placenta and kidney) or calbindin-D 28K (kidney only) as described previously (Thomasset et al 1982, Lomri et al 1989, with the addition, at the end of the previous method, of two stringency washes (0·1 SSC, 0·1% SDS at 60 C for 20 min) for calbindin-D 28K hybridisations.…”

Section: Rna Extraction and Northern/dot Blot Analysismentioning

confidence: 99%

Altered calbindin mRNA expression and calcium regulating hormones in rat diabetic pregnancy

Hamilton¹,

Tein²,

Glazier³

et al. 2000

Journal of Endocrinology

View full text Add to dashboard Cite

Offspring of rats with diabetes mellitus are at risk of reduced calcium and bone mineral content. Altered expression of the maternal calcium binding proteins, calbindin-D 9K and calbindin-D 28K , which are involved in renal and placental calcium transport, may underlie these problems.We have investigated the effect of diabetes on circulating concentrations of regulatory hormones with respect to calbindin-D mRNA concentrations. Three rat groups were studied; control (CP), streptozotocininduced diabetic (DP), and insulin-treated diabetic (DPI) pregnant rats. Calbindin-D 9K and calbindin-D 28K mRNA abundance in placenta and maternal kidney were measured at days 7, 15, 18 and 21 of gestation, together with serum or plasma concentrations of 1,25 dihydroxyvitamin D 3 (1,25(OH) 2 D 3 ), parathyroid hormone (PTH), PTH-related protein (PTHrP), calcitonin, oestradiol and IGF-I. An increase in placental calbindin-D 9K mRNA abundance between days 18 and 21 in CP and DPI rats was severely blunted in the DP rats. In contrast, renal calbindin-D 28K mRNA abundance was greater at days 7, 15 and 18 in DP compared with CP rats, as was calbindin-D 9K at day 18. Calcitonin concentrations showed no differences between the groups, and both PTH and IGF-I were reduced over the first half of gestation, unlike the calbindins. In contrast, the concentrations of PTHrP and 1,25(OH) 2 D 3 were reduced at term in the DP group compared with the other two groups. Plasma oestradiol concentrations were lower in DP than in CP rats at days 7, 15 and 18, and most striking was the absence in DP rats of the peak of oestradiol seen at day 18 in CP rats. Despite the similarity between changes in placental calbindin mRNA and 1,25(OH) 2 D 3 , previous work has shown placental calbindin-D 9K regulation to be vitamin-D-independent. These studies produce suggestive evidence, therefore, that PTHrP and oestradiol may be involved in the altered calbindin-D expression by kidney and placenta in rat diabetic pregnancy.

show abstract

Section: Rna Extraction and Northern/dot Blot Analysismentioning

confidence: 99%

Altered calbindin mRNA expression and calcium regulating hormones in rat diabetic pregnancy

Hamilton¹,

Tein²,

Glazier³

et al. 2000

Journal of Endocrinology

View full text Add to dashboard Cite

show abstract

“…Single stranded DNA was generated by incubating total RNA with avian myeloblastosis virus reverse transcriptase (AMV-RT) in the presence of oligo dT (10 ng/µl), 1 mM dNTPs, 8 mM MgCl 2 , and ribonuclease inhibitor (RNasin, Promega). A 780 base pair fragment of calbindin D-28K was synthesized using the published rat sequence sense primer 5' GG-CAGAATCCCACCTGCAGT and anti-sense primer 5' GTTGTCCCCAGCAGAGAGAA [Lomri et al, 1989]. The PCR mixture contained single stranded DNA, 10 pmol of each primer and 0.2 mM of each dNTP in 50 mM KCl, 10 mM Tris.HCl (pH 9.0), 2.0 mM MgCl 2 , 0.1% Triton X-100, and 1-5 units of thermus aquaticus (Taq) DNA polymerase.…”

Section: Cdna Cloningmentioning

confidence: 99%

Estrogen responsiveness of renal calbindin-D28k gene expression in rat kidney

Criddle¹,

Zheng²,

Dick³

et al. 1997

J. Cell. Biochem.

View full text Add to dashboard Cite

In women, calcium excretion in the urine rises after menopause and falls with estrogen replacement therapy. The amount of calcium lost in the urine following estrogen therapy is less than should occur based on changes in serum calcium and the amount of calcium filtered by the kidney. This suggests there may be a direct effect of estrogen therapy to increase renal calcium reabsorption. Calbindin D28k is a putative calcium ferry protein located in the distal renal tubules which has been shown to increase transcellular calcium transport. We proposed that estrogen loss after menopause may diminish gene expression of renal calbindin D28k and subsequently diminish renal calcium reabsorption. We used the ovariectomized rat model of estrogen deficiency to investigate changes at the messenger RNA level of calbindin D28k in ovariectomized rats (OVX), sham ovariectomized rats (S-OVX), and estrogen treated ovariectomized rats (E-OVX). We have demonstrated that ovariectomy in rats diminishes the gene expression of renal calbindin D28k. The mRNA levels were approximately three times lower in OVX rats than S-OVX rats. Administration of 17 beta estradiol to OVX rats produced a significant increase in mRNA level to greater than the S-OVX rats by 4 h. Measurement of serum 1,25 dihydroxyvitamin D3 showed lower levels in OVX rats than S-OVX rats but no significant change in E-OVX animals. In conclusion, our results indicate that estrogen increases renal calbindin D28k mRNA levels, by a mechanism independent of changes in 1,25 dihydroxyvitamin D3. This may result in increased expression of calbindin D28k protein which may have a role in reducing renal calcium excretion.

show abstract

“…CaBP-d28k was originally purified from chicken intestine (8) but is also expressed in kidney and throughout the nervous system (9,10) in species ranging from invertebrates to mammals (11). In the rat, CaBP-d9k has been demonstrated in the uterine stroma and myometrium, with uterine expression decreasing around the time of embryo implantation on day 5 (d5) of pregnancy (12).…”

mentioning

confidence: 99%

Endometrial calbindins are critical for embryo implantation: Evidence fromin vivouse of morpholino antisense oligonucleotides

Luu

Nie

Salamonsen

2004

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The endometrium is receptive to embryo implantation only for a short period in each reproductive cycle: development of receptivity requires alterations in endometrial gene expression. Calbindin (CaBP)-d9k and CaBP-d28k are related proteins containing EF hand motifs that have a high affinity for Ca 2؉ . We previously demonstrated that endometrial expression of CaBP-d9k mRNA is highly regulated during implantation in the mouse. This project aimed to determine the temporal and spatial expression of both CaBP proteins during early pregnancy and to establish whether they are necessary for blastocyst implantation. CaBP-d28k protein, like CaBP-d9k, was up-regulated in the endometrial epithelium just before implantation but disappeared at implantation sites after attachment. By the judicious intrauterine injection of morpholino oligonucleotides (MO) against CaBP-d9k into WT and CaBP-d28k null mice just before implantation, we selectively eliminated one or both CaBPs from the uterine epithelium. Implantation was blocked only when both CaBP-d9k and CaBP-d28k were absent: treated WT mice and untreated CaBP-d28k null mice were fertile. Furthermore, the effect on implantation was highly dependent on the timing of injection of MO. This report examining the function of implantation-related genes in the uterus using MO demonstrates that this technique is a highly effective means to specifically target uterine proteins in vivo. This study provides evidence for an absolute requirement for CaBPs during the early phase of embryo implantation, and thus that regulation of Ca 2؉ availability in the uterine environment of the implanting embryo is critical for successful implantation.

show abstract

Cloning and analysis of calbindin-D28K cDNA and its expression in the central nervous system

Cited by 38 publications

References 40 publications

Altered calbindin mRNA expression and calcium regulating hormones in rat diabetic pregnancy

Altered calbindin mRNA expression and calcium regulating hormones in rat diabetic pregnancy

Estrogen responsiveness of renal calbindin-D28k gene expression in rat kidney

Endometrial calbindins are critical for embryo implantation: Evidence fromin vivouse of morpholino antisense oligonucleotides

Contact Info

Product

Resources

About