Cloning and characterization of canine prostate‐specific membrane antigen

Schmidt, Sonja; Fracasso, Giulio; Colombatti, Marco; Naim, Hassan Y.

doi:10.1002/pros.22605

Cited by 8 publications

(8 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Yet, PSMA was reported to be a ~100–110-kDa glycoprotein in LNCaP, consisting of a 84-kDa protein moiety predicted from the cDNA and carbohydrates accounting for 20–25 % of its mass [ 32 ]. The reported homology between the human and canine protein sequence (82 % identity) [ 27 ] together with our findings of a similar protein band in LNCaP and DPC-1 suggest comparable glycosylation patterns. Nonetheless, the fact that 17G1 recognized native forms of PSMA is most valuable in the context of molecular imaging whereby intravenously injected radiotracers recognize accessible epitopes in native proteins.…”

Section: Discussionsupporting

confidence: 80%

“…PSMA protein sequences in human and canine are highly homologous [ 27 ], notably in the amino acid sequence 490–500 of the human peptide (GKSLYESW TK K) used to generate 17G1 [ 23 ] compared to the equivalent canine amino acid sequence (GKSLYESW NE K). Accordingly, the reactivity of 17G1 towards canine PSMA was ascertained and compared to J591.…”

Section: Resultsmentioning

confidence: 99%

“…PSMA was a reasonable target to choose in this proof-of-concept study given its reported expression in DPC-1 tumors [ 21 ] and confirmed in this study. We selected the 17G1 mAb [ 23 ] for imaging as it was raised against a human PSMA peptide highly homologous to the corresponding peptide sequence in canine PSMA [ 23 , 27 ]. Moreover and similarly to J591, 17G1 recognizes the human PSMA protein, recombinant and as a ~100-kDa band in LNCaP.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

The dog prostate cancer (DPC-1) model: a reliable tool for molecular imaging of prostate tumors and metastases

Chevalier

Moffett²,

Turcotte

et al. 2015

EJNMMI Res

View full text Add to dashboard Cite

BackgroundClinical applicability of newly discovered reagents for molecular imaging is hampered by the lack of translational models. As the dog prostate cancer (DPC-1) model recapitulates in dogs the natural history of prostate cancer in man, we tested the feasibility of single-photon emission computed tomography (SPECT)/CT imaging in this model using an anti-prostate-specific membrane antigen (PSMA)/17G1 antibody as the radiotracer.MethodsImmunoblots and immunohistochemistry (IHC) with 17G1 were performed on canine and human prostate cancer cell lines and tissues. Five dogs with DPC-1 tumors were enrolled for pelvic and, in some instances, thoracic SPECT/CT procedures, also repeated over time. Controls included 111indium (In)-17G1 prior to DPC-1 implantation and 111In-immunoglobulins (IgGs) prior to imaging with 111In-17G1 in dogs bearing prostatic DPC-1 tumors.Results17G1 cross-reactivity with canine PSMA (and J591) was confirmed by protein analyses on DPC-1, LNCaP, and PC-3 cell lines and IHC of dog vs. human prostate tissue sections. 17G1 stained luminal cells and DPC-1 cancer cells in dog prostates similarly to human luminal and cancer cells of patients and LNCaP xenografts. SPECT/CT imaging revealed low uptake (≤2.1) of both 111In-17G1 in normal dog prostates and 111In-IgGs in growing DPC-1 prostate tumors comparatively to 111In-17G1 uptake of 3.6 increasing up to 6.5 values in prostate with DPC-1 lesions. Images showed a diffused pattern and, occasionally, a peripheral doughnut-shape-like pattern. Numerous sacro-iliac lymph nodes and lung lesions were detected with contrast ratios of 5.2 and 3.0, respectively. The highest values were observed in pelvic bones (11 and 19) of two dogs, next confirmed as PSMA-positive metastases.ConclusionsThis proof-of-concept PSMA-based SPECT/CT molecular imaging detecting primary prostate tumors and metastases in canines with high cancer burden speaks in favor of this large model’s utility to facilitate technology transfer to the clinic and accelerate applications of new tools and modalities for tumor staging in patients.Electronic supplementary materialThe online version of this article (doi:10.1186/s13550-015-0155-6) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionsupporting

confidence: 80%

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

The dog prostate cancer (DPC-1) model: a reliable tool for molecular imaging of prostate tumors and metastases

Chevalier

Moffett²,

Turcotte

et al. 2015

EJNMMI Res

View full text Add to dashboard Cite

show abstract

“…Total RNA from each cell line was extracted using the Absolutely RNA RT-PCR Miniprep Kit (Agilent Technologies). Approximately 0.5 mg of each RNA was reverse transcribed with SuperScript II Reverse Transcriptase and oligo(dT) [12][13][14][15][16][17][18] primer (Invitrogen). Quantitative real-time RT-PCR analysis was performed using QuantiTect SYBR Green PCR Kit (Qiagen, Inc.) along with primers for canine GAPDH: forward CCCACTCTTCCACCTTCGAC and reverse AGCCAAATTCATTGTCATACCAGG; and canine PSMA: forward GCAGGGGACCCTCTCACACCTG and reverse CTCGGAAGACCAACAGCCTCTGTGA.…”

Section: Rna Extraction Reversetranscription and Real-time Rt-pcrmentioning

confidence: 99%

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells

Johnson

Simmons

et al. 2014

Prostate

View full text Add to dashboard Cite

BACKGROUND Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. METHODS Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. RESULTS Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGgG) were determined to be 393 nM and 220 pmol min −1 mg protein −1, respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. CONCLUSIONS The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly, the findings demonstrate that the potential of the inhibitors for use in diagnosis and therapy can be evaluated in an immunocompetent animal model that naturally develops prostate cancer before use in humans.

show abstract

“…PSMA expression levels can also be elevated on other malignant cells including those of urologic origin (i.e., kidney and bladder) suggesting this glycoprotein may play a role in their oncogenic progression as well [ 11 ]. In other solid tumors including colon, ovarian, breast, and kidney cancers, elevated PSMA expression has been observed on tumor neovasculature, but not normal vasculature suggesting a role for PSMA in angiogenesis [ 12 ]. Unlike prostate-specific antigen (PSA), PMSA is a membrane protein which makes it an attractive target to develop mAbs against it for diagnostic and therapeutic purposes [ 13 ].…”

Section: Introductionmentioning

confidence: 99%

Novel prostate cancer immunotherapy with a DNA-encoded anti-prostate-specific membrane antigen monoclonal antibody

Muthumani

Marnin

Kudchodkar

et al. 2017

Cancer Immunol Immunother

View full text Add to dashboard Cite

Prostate-specific membrane antigen (PSMA) is expressed at high levels on malignant prostate cells and is likely an important therapeutic target for the treatment of prostate carcinoma. Current immunotherapy approaches to target PSMA include peptide, cell, vector or DNA-based vaccines as well as passive administration of PSMA-specific monoclonal antibodies (mAb). Conventional mAb immunotherapy has numerous logistical and practical limitations, including high production costs and a requirement for frequent dosing due to short mAb serum half-life. In this report, we describe a novel strategy of antibody-based immunotherapy against prostate carcinoma that utilizes synthetic DNA plasmids that encode a therapeutic human mAb that target PSMA. Electroporation-enhanced intramuscular injection of the DNA-encoded mAb (DMAb) plasmid into mice led to the production of functional and durable levels of the anti-PSMA antibody. The anti-PSMA produced in vivo controlled tumor growth and prolonged survival in a mouse model. This is likely mediated by antibody-dependent cellular cytotoxicity (ADCC) effect with the aid of NK cells. Further study of this novel approach for treatment of human prostate disease and other malignant conditions is warranted.

show abstract

Cloning and characterization of canine prostate‐specific membrane antigen

Cited by 8 publications

References 13 publications

The dog prostate cancer (DPC-1) model: a reliable tool for molecular imaging of prostate tumors and metastases

The dog prostate cancer (DPC-1) model: a reliable tool for molecular imaging of prostate tumors and metastases

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells

Novel prostate cancer immunotherapy with a DNA-encoded anti-prostate-specific membrane antigen monoclonal antibody

Contact Info

Product

Resources

About