Cloning and characterization of the gene as a selectable marker

Thor, Der; Xiong, See; Orazem, Claire C.; Kwan, An-Chun; Cregg, James M.; Lin‐Cereghino, Joan; Lin-Cereghino, Geoff P.

doi:10.1016/j.femsyr.2005.03.009

Cited by 38 publications

(33 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The rapid colony PCR method, used to determine the presence of the kan r gene in cells, has been described previously (Thor et al, 2005). Plasmid DNA was purified from Escherichia coli cultures, using a QIAprep Spin Miniprep Kit (Qiagen).…”

Section: Miscellaneous Methodsmentioning

confidence: 99%

“…Primers used to amplify the β-lactamase target gene were blacs5 ctcgccttgatcgttgggaa and blacas3 cagtgctgcaatgataccgc. Primers used to amplify the MET2 (Thor et al, 2005) reference gene were mets100 cgttctcgcaactctttcgaa and metas100 caatggcatcagttatgacggaag. All samples were performed in duplicate, and all samples were tested several times in different experiments.…”

Section: Real-time Pcrmentioning

confidence: 99%

See 1 more Smart Citation

Direct selection of Pichia pastoris expression strains using new G418 resistance vectors

Lin‐Cereghino

Hashimoto

Moy

et al. 2008

Yeast

View full text Add to dashboard Cite

The methylotrophic yeast, Pichia pastoris, is widely used as a host organism for the expression of heterologous proteins. Currently, the Zeocin and blasticidin resistance genes are the only dominant selectable markers that can be used for primary selection of transformants. In this report we describe new expression vectors that can be used to select directly for P. pastoris transformants using G418 resistance conferred by a modified Tn903kan r gene. Compared to other dominant markers, this system is more economical and offers a higher transformation efficiency, due to the small sizes of the cloning vectors, pKAN B and pKANα B (GenBank Accession Nos EU285585 and EU285586, respectively). Additionally, multicopy transformants can be generated using these new vectors.

show abstract

Section: Miscellaneous Methodsmentioning

confidence: 99%

Section: Real-time Pcrmentioning

confidence: 99%

Direct selection of Pichia pastoris expression strains using new G418 resistance vectors

Lin‐Cereghino

Hashimoto

Moy

et al. 2008

Yeast

View full text Add to dashboard Cite

show abstract

“…Transformation systems for these so called nonconventional yeasts depend heavily on those developed for S. cerevisiae [75]. The most commonly used markers are derived from the biosynthetic pathway of the homologous system, but those from S. cerevisiae are also found to be effective [76][77][78]. Endogenous plasmids have been isolated and characterized for Yarrowia lipolytica, K. lactis, Z. rouxxii, and Z. baili [34].…”

Section: Methods Of Recombinant Dna Technology In Yeastmentioning

confidence: 99%

Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Leisegang

Nevoigt

Spielvogel

et al. 2006

Genetically Engineered Food

View full text Add to dashboard Cite

“…Several vectors are available which have auxotrophic markers for elements of the arginine, adenine, histidine, uracil and methionine biosynthetic pathways in P. pastoris (Lin Cereghino et al, 2001;Nett and Gerngross, 2003;Nett et al, 2005;Thor et al, 2005). However, these vectors require sequential transformation for the selection of more than one expression cassette and concomitant expression of several heterologous genes.…”

Section: Introductionmentioning

confidence: 99%

Expression of GFP using Pichia pastoris vectors with zeocin or G‐418 sulphate as the primary selectable marker

Papakonstantinou

Harris

Hearn

2009

Yeast

View full text Add to dashboard Cite

Pichia pastoris is a popular host organism for expressing heterologous proteins, and various expression vectors for this yeast are currently available. Recently, vectors containing novel dominant antibiotic resistance markers have become a strong and developing field of research for this methylotropic yeast strain. We have developed new P. pastoris expression vectors, the pPICKanMX6 and pPICKanMX6α series. These vectors were constructed by replacing the zeocin resistance gene of the pPICZA, B, C and pPICZαA, B and C vectors with the Tn903 kan R marker from pFA6a KanMX6, which confers G-418 sulphate resistance in P. pastoris. The limits of antibiotic resistance in two transformant yeast strains were investigated, and the selection marker was shown to be stably retained. To demonstrate their usefulness, a gene encoding hexa-histidine-tagged green fluorescent protein (GFPH6) was cloned into one of the new vectors and GFP expression examined in P. pastoris cells. The protein expression levels using the pPICKanMX6B vector were comparable with that using the original plasmid, based on zeocin resistance as seen by yeast cell fluorescence. Moreover, GFPH6 was able to be isolated by immobilized metal ion affinity chromatography (IMAC) from lysates of both yeast strains. A model reporter construct has been used to demonstrate successful recombinant protein expression and its subsequent purification using these new vectors. Corresponding vectors can now also be engineered with foreign gene expression under the control of various different promoters, to increase the flexibility of P. pastoris as a cellular factory for heterologous protein production.

show abstract

Cloning and characterization of the gene as a selectable marker

Cited by 38 publications

References 19 publications

Direct selection of Pichia pastoris expression strains using new G418 resistance vectors

Direct selection of Pichia pastoris expression strains using new G418 resistance vectors

Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Expression of GFP using Pichia pastoris vectors with zeocin or G‐418 sulphate as the primary selectable marker

Contact Info

Product

Resources

About