Cloning and expression of a gene from Streptomyces scabies encoding a putative pathogenicity factor

Abstract

We cloned a 9.4-kb DNA fragment from Streptomyces scabies ATCC 41973 that allows the nonpathogen Streptomyces lividans 66 TK24 to necrotize and colonize potato tuber slices and produce scab-like symptoms on potato minitubers. Deletion analysis demonstrated that activity was conferred by a 1.6-kb DNA region. Sequence analysis of a 2.4-kb DNA fragment spanning the DNA region necessary for activity revealed three open reading frames (ORFs). The deduced amino acid sequence of ORF1, designated ORFtnp, showed high levels of identity with the first 233 amino acids of the putative transposases of the IS1164 elements from Rhodococcus rhodochrous (71%) and Mycobacterium bovis (68%), members of the Staphylococcus aureus IS256 family of transposases. No significant homologies to ORF2 and ORF3 were found in the nucleic acid and protein databases. ORFtnp is located 5 of ORF3. ORF2 is incomplete and is located 3 of ORF3. Subcloning of the individual ORFs demonstrated that ORF3, designated nec1, is sufficient for necrotizing activity in S. lividans 66 TK24. S. lividans 66 TK24 expressing nec1 does not produce thaxtomin A but produces an unidentified extracellular water-soluble compound that causes necrosis on potato tuber discs. The G؉C content of nec1 suggests that it has moved horizontally from another genus. Southern analysis of ORFtnp and nec1 demonstrate that these genes are physically linked in Streptomyces strains, including S. scabies and Streptomyces acidiscabies strains, that are pathogenic on potato and that produce the phytotoxin thaxtomin A. These data suggest that nec1 may have been mobilized into S. scabies through a transposition event mediated by ORFtnp.Streptomyces spp. are gram-positive filamentous bacteria. Almost all described species are soil saprophytes, and many produce biologically active secondary metabolites, including antibiotics. However, a few species are plant pathogenic. These species infect underground structures of many plant species. Streptomyces scabies (Thaxt.) Lambert and Loria (22) is the predominant and best-studied of the plant-pathogenic species and causes an economically important disease of potato tubers called potato scab (28,29). Streptomyces acidiscabies Lambert and Loria, although apparently limited in distribution, also causes disease on potato tubers (21). The symptoms caused by S. acidiscabies are indistinguishable from those caused by S. scabies, and both species infect tap roots of radish, turnip, and other crops (23). Streptomyces ipomoeae (Person and Martin) Waksman and Henrici (43) infects storage and fibrous roots of sweet potato (6). There is evidence that several other Streptomyces species may be able to cause disease on plants (reviewed in reference 27).Plant-pathogenic Streptomyces species are diverse, based on physiological, morphological, DNA-DNA hybridization, and ribosomal analyses (13,20,39). However, similarities in host range and disease symptomology for some of these species suggest a common mechanism of pathogenicity. Thaxtomins are unique 4-nitroindol-3-yl-c...

Isolation and Identification of Actinobacteria from Surface-Sterilized Wheat Roots

“…among the actinobacterial endoflora of wheat that was observed in the present study was also noted by Sardi et al (35) on field crops and Italian native plants and as a result of the molecular characterization of the bacterial population within potatoes (36). However, these results would suggest that the endophytic microflora of wheat is different from that reported in maize, where the genus Microbispora, followed by Streptomyces and Streptosporangium, was most commonly isolated (9). However, the differences between the observed endophytic actinobacterial communities between these plants are the relative proportions of one genus to another, possibly due to bias in the isolation method, since all of the genera isolated from maize plant tissue were also isolated from wheat.…”

“…These included S. scabies ATCC 49173, S. acidiscabies ATCC 49003, S. setonii ATCC 25497, and S. caviscabies ATCC 51928. The nec1 gene fragment was amplified with the Nf (5Ј-AT GAGCGCGAACGGAAGCCCCGGA) and Nr (5Ј-GCAGGTCGTCACGAAG GATCG) primers (9). These primers were used in the following 25-l reaction mixture: primers (200 ng l Ϫ1 ), 1 l each; 5ϫ Taq buffer (including deoxynucleoside triphosphates), 5 l; water, 15.5 l; Taq polymerase (2 U l Ϫ1 ), 0.5 l; and template DNA, 2 l. The following thermal profile was used: 95°C for 2 min; followed by 30 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 2 min; and then a 15°C soak.…”

“…The best-characterized examples of the plant-pathogenic actinobacteria are the potato scab-causing Streptomyces scabies, S. acidiscabies, and S. turgidiscabies. Pathogenicity has been associated with the presence of a conserved and transmissible pathogenicity island (PAI) in their genomes (9,21). This PAI encodes for the biosynthesis of a phytotoxin, thaxtomin, and also contains plant virulence factor genes such as nec1 (8,22,26).…”

Involvement of a Cytochrome P450 Monooxygenase in Thaxtomin A Biosynthesis by Streptomyces acidiscabies

“…Our analysis of the region also identified truncated homologs of other genes, including a pathogenicity-associated transposase. The chimeric architecture of the txt region in particular serves to further support our model of the recent pathogenicity island-mediated emergence of taxonomically diverse Streptomyces pathogens (4,5,13). Our analysis of the 5-kb region did not reveal the presence of any ORFs resembling the class I P450 redox partner proteins, ferredoxin or the FAD-containing NAD(P)H ferredoxin oxidoreductase.…”

Streptomyces scabies87-22 Possesses a Functional Tomatinase

“…The biosynthesis of thaxtomin has been characterized (19,20,29), and transcription of the biosynthetic genes is activated by the AraC family regulator TxtR, which binds cellobiose to facilitate transcription (25). Scab-causing streptomycetes also contain a novel necrogenic protein, Nec1, which is important in pathogenesis and may be involved in the suppression of plant defenses (10,24). Recently, sequencing of a self-mobilizable pathogenicity island in S. turgidiscabies revealed that a putative tomatinase gene was conserved among three phylogenetically distinct scab-causing streptomycetes, S. turgidiscabies Car8, S. acidiscabies, and S. scabies (also known as S. scabiei) 87-22 (28).…”