Cloning, expression and characterization of an alkaline thermostable GH9 endoglucanase from Thermobifida halotolerans YIM 90462T

Expression and characteristics of a Ca2+-dependent endoglucanase from Cytophaga hutchinsonii

“…In literatures, Ca 2+ can enhance the cellulases' activity by 10-fold at most (Chauvaux et al 1990). Usually, it is considered that Ca 2+ could enhance the activity of cellulases by stabilizing them under high temperature (Chauvaux et al 1990;Eckert et al 2002;Zhang et al 2011). However, in this study, CHU_1280 was a Ca 2+ -dependent processive endoglucanase which had no activity in the absence of Ca 2+ .…”

“…Ten GH9 cellulases in bacteria have been crystallized, and they all contain Ca 2+ -binding sites (according to the RCSB protein data bank). It was reported that Ca 2+ could enhance the activity of some cellulases by improving their thermostability (Chauvaux et al 1990;Eckert et al 2002;Zhang et al 2011).…”

Actinomycetes: A Source of Industrially Important Enzymes

“…Actinomycetes strains e.g. Streptomyces erumpens and Thermobifida fusca have ability to secrete amylases to the outside of the cells to carry out extracellular digestion [13,14]. These thermostable enzymes can be used in baking, pharmaceutical, paper and pulp industry.…”

Cloning, expression and characterization of a novel GH5 exo/endoglucanase of Thermobifida halotolerans YIM 90462T by genome mining

“…E. coli Top10 (Invitrogen, China) and BL21(DE3) (Novagen, Germany) strains were grown at 37 C in LuriaeBertani broth or agar supplemented with the appropriate antibiotic (13).…”

“…Genomic DNA was prepared as described previously (13). The coding sequence, including the predicted signal peptide, was amplified by PCR using two primers: thcel5AF (CGGCACATATGACCAGATCCCCCACC, containing an NdeI site) and thcel5AR (ATACTCGAGGTCCCCGCGGAGCTGG, containing an XhoI site).…”