Cloning of Complementary DNA for GAP-43, a Neuronal Growth-Related Protein

Karns, Larry R.; Ng, Shi-Chung; Freeman, John A.; Fishman, Mark C.

doi:10.1126/science.2437653

Cited by 339 publications

(133 citation statements)

References 27 publications

Supporting

Mentioning

127

Contrasting

Order By: Relevance

“…GAP-43 is involved in signals that regulate cytoskeletal organization in the nerve ending (Benowitz and Routtenberg, 1997) and GAP-43-deficient mice exhibit re- stricted axonal pathfinding defects (Strittmatter et al, 1995;Sretavan and Kruger, 1998). Moreover, its expression is dramatically enhanced during neuronal development and after nerve injury (Skene and Willard, 1981;Karns et al, 1987). On the other hand, paralemmin is enriched both in axons and dendrites as well as at pre-and postsynaptic sites (Kutzleb et al, 1998).…”

Section: Possible Roles In Synaptogeneismentioning

confidence: 99%

Regulation of Dendritic Branching and Filopodia Formation in Hippocampal Neurons by Specific Acylated Protein Motifs

Gauthier-Campbell

Bredt

Murphy

et al. 2004

MBoC

View full text Add to dashboard Cite

Although neuronal axons and dendrites with their associated filopodia and spines exhibit a profound cell polarity, the mechanism by which they develop is largely unknown. Here, we demonstrate that specific palmitoylated protein motifs, characterized by two adjacent cysteines and nearby basic residues, are sufficient to induce filopodial extensions in heterologous cells and to increase the number of filopodia and the branching of dendrites and axons in neurons. Such motifs are present at the N-terminus of GAP-43 and the C-terminus of paralemmin, two neuronal proteins implicated in cytoskeletal organization and filopodial outgrowth. Filopodia induction is blocked by mutations of the palmitoylated sites or by treatment with 2-bromopalmitate, an agent that inhibits protein palmitoylation. Moreover, overexpression of a constitutively active form of ARF6, a GTPase that regulates membrane cycling and dendritic branching reversed the effects of the acylated protein motifs. Filopodia induction by the specific palmitoylated motifs was also reduced upon overexpression of a dominant negative form of the GTPase cdc42. These results demonstrate that select dually lipidated protein motifs trigger changes in the development and growth of neuronal processes. INTRODUCTIONNeurons possess an elaborate plasma membrane architecture that includes axons, dendrites, and synaptic sites (Da Silva and Dotti, 2002). Modulation of the plasma membrane shape and composition regulate processes outgrowth, axonal development, dendritic branching, and the construction of synapses (Jontes and Smith, 2000). These changes are regulated by interactions between the constituents of the plasma membrane, the exo/endocytic vesicles, and the cytoskeleton (Wood and Martin, 2002). In nonneuronal cells, differential modulation of membrane flow can result in the formation of processes such as microspikes, lamellopodia, and filopodia (Wood and Martin, 2002). However, factors that regulate the formation and maintenance of specific classes of membranous processes in neuronal cells remain poorly understood.Dendritic filopodia, cell surface extensions filled with tight parallel bundles of actin filaments, are thought to be precursors for developing synapses (Dailey and Smith, 1996;Small, 1988). Filopodia are typically 5-35 m in length and rapidly alter their position and shape. In developing axons, filopodia occur at the tips of growth cones and may aid the axon in finding its appropriate target. In dendrites, filopodia act as precursors to spines, short bulbous protrusions of the dendrite that form excitatory postsynaptic contacts on many neurons (Jontes and Smith, 2000). Thus, changes in membrane structure that result in the formation of filopodia are likely important in axonal guidance and spine formation. In contrast, dendritic branching is thought to be mediated via an actin and/or microtubule-dependent mechanisms (Jan and Jan, 2003). Recent studies showed that in early neuronal development dendrites originate from lamellopodia and short neurites (Jan and Jan, ...

show abstract

Section: Possible Roles In Synaptogeneismentioning

confidence: 99%

Regulation of Dendritic Branching and Filopodia Formation in Hippocampal Neurons by Specific Acylated Protein Motifs

Gauthier-Campbell

Bredt

Murphy

et al. 2004

MBoC

View full text Add to dashboard Cite

show abstract

“…Growth-associated protein 43 (GAP-43) is a spe- cific phosphoprotein of the nervous system and is formed at the leading edge of the elongation axon (43,44). Importantly axonal transport and expression of GAP-43 occur only in neurons that are extending during development or are regenerating after injury (45).…”

Section: Functional Recovery After Afgf Treatment In Rat Model With Cmentioning

confidence: 99%

Involvement of Acidic Fibroblast Growth Factor in Spinal Cord Injury Repair Processes Revealed by a Proteomics Approach

Tsai¹,

Shen²,

Kuo

et al. 2008

Molecular & Cellular Proteomics

View full text Add to dashboard Cite

Acidic fibroblast growth factor (aFGF; also known as FGF-1) is a potent neurotrophic factor that affects neuronal survival in the injured spinal cord. However, the pathological changes that occur with spinal cord injury (SCI) and the attribution to aFGF of a neuroprotective effect during SCI are still elusive. In this study, we demonstrated that rat SCI, when treated with aFGF, showed significant functional recovery as indicated by the Basso, Beattie, and Bresnahan locomotor rating scale and the combined behavior score (p < 0.01-0.001). Furthermore proteomics and bioinformatics approaches were adapted to investigate changes in the global protein profile of the damaged spinal cord tissue when experimental rats were treated either with or without aFGF at 24 h after injury. We found that 51 protein spots, resolvable by two-dimensional PAGE, had significant differential expression. Using hierarchical clustering analysis, these proteins were categorized into five major expression patterns. Noticeably proteins involved in the process of secondary injury, such as astrocyte activation (glial fibrillary acidic protein), inflammation (S100B), and scar formation (keratan sulfate proteoglycan lumican), which lead to the blocking of injured spinal cord regeneration, were down-regulated in the contusive spinal cord after treatment with aFGF. We propose that aFGF might initiate a series of biological processes to prevent or attenuate secondary injury and that this, Spinal cord injury (SCI)1 is a costly disease as well as the most frequent cause of mortality and morbidity in every medical care system around the world (1, 2). Traumatic axonal injury is a primary sequela of contusive SCI and is characterized by axonal swelling and disconnection of the ascending sensory and descending motor tracts (3). Contusive SCI seems to initiate a complicated cascade of pathophysiological changes, a process called secondary injury, including fiber deformation, increased vascular permeability, local ischemia, intraneuronal edema, and local demyelination. Moreover traumatic axonal injury typically involves a disruption of the axonal membrane, and this results in up-regulation of the entry of calcium, the influx of which initiates calpain activation (4, 5) and mitochondrial injury/swelling (6), resulting in cytochrome c release and caspase activation (7). Simultaneously the proliferation and hypertrophy of astrocytes around the injury site are characterized by increased immunoreactivity to glial fibrillary acidic proteins (GFAPs) (8).Although many studies have focused on revealing the pathophysiology of SCI, the exact molecular mechanisms and the biochemical pathways that mediate secondary injury remain sketchy (9). Spinal cord injury often causes permanent neurological deficits mostly because the injured neurons lack regenerative ability, and the series of destructive processes that follow SCI results in a second wave of cell death and spreading tissue loss (10). Therefore, studies of the stimulaFrom the ‡Institute

show abstract

“…The temperature profile for PCR reactions was 45 min at 45°C, 2 min at 94°C, 22 cycles of 94°C for 30 s, 55°C for 1 min, and 68°C for 2 min, followed by a final cycle of 7 min at 68°C. Primers used for RT-PCR reactions were: 5ЈATAAGTAAGGGTGAGAAATTCAGG3Ј and 5ЈTGCTTAATATGGCCTTATGGCG3Ј (Steller et al, 1996) for rat HuD, 5ЈGGAATAAGGATCCGAGGAGGAAAGGAG3Ј, 5ЈCTTA-AAGTTCAGGCATGTTCTTGGT3Ј (Basi et al, 1987;Karns et al, 1987) for rat GAP-43, and 5ЈCCCACGGCAAGTTCAAC3Ј and 5ЈTGGCAGGTTTCTCCAGGCGGC3Ј (accession number XO2231) for G3PD. Rat-specific HuD primers were derived from nonconserved sequences in the 3Ј UTR and did not detect human HuD sequences (data not shown).…”

Section: Northern Blots and Quantitative Rt-pcrmentioning

confidence: 99%

The RNA-binding Protein HuD Is Required for GAP-43 mRNA Stability, GAP-43 Gene Expression, and PKC-dependent Neurite Outgrowth in PC12 Cells

Mobarak¹,

Anderson²,

Morin³

et al. 2000

MBoC

126

146

View full text Add to dashboard Cite

The RNA-binding protein HuD binds to a regulatory element in the 3Ј untranslated region (3Ј UTR) of the GAP-43 mRNA. To investigate the functional significance of this interaction, we generated PC12 cell lines in which HuD levels were controlled by transfection with either antisense (pDuH) or sense (pcHuD) constructs. pDuH-transfected cells contained reduced amounts of GAP-43 protein and mRNA, and these levels remained low even after nerve growth factor (NGF) stimulation, a treatment that is normally associated with protein kinase C (PKC)-dependent stabilization of the GAP-43 mRNA and neuronal differentiation. Analysis of GAP-43 mRNA stability demonstrated that the mRNA had a shorter half-life in these cells. In agreement with their deficient GAP-43 expression, pDuH cells failed to grow neurites in the presence of NGF or phorbol esters. These cells, however, exhibited normal neurite outgrowth when exposed to dibutyryl-cAMP, an agent that induces outgrowth independently from GAP-43. We observed opposite effects in pcHuD-transfected cells. The GAP-43 mRNA was stabilized in these cells, leading to an increase in the levels of the GAP-43 mRNA and protein. pcHuD cells were also found to grow short spontaneous neurites, a process that required the presence of GAP-43. In conclusion, our results suggest that HuD plays a critical role in PKC-mediated neurite outgrowth in PC12 cells and that this protein does so primarily by promoting the stabilization of the GAP-43 mRNA. INTRODUCTIONIn addition to transcriptional factors, RNA-binding proteins play a critical role in the developmental control of gene expression. Among these is ELAV (embryonic lethal abnormal vision), an RNA-binding protein identified in Drosophila, where the gene is required for normal development and maintenance of the nervous system (Campos et al., 1985;Robinow et al., 1988). In higher vertebrates and mammals, four members of the ELAV-like family have been identified. These are also referred to as Hu proteins, namely HuR (also known as HuA), HuB (Hel-N1), HuC, and HuD, because these are targets of anti-Hu antibodies present in the sera of patients with paraneoplastic encephalomyelitis (Dalmau et al., 1992). HuR is ubiquitously expressed (Ma et al., 1996), while HuB, HuC, and HuD are expressed uniquely in the nervous system. Recent studies indicate that overexpression of neural ELAV-like proteins is sufficient to induce neuronal differentiation in vitro and in vivo (Wakamatsu and Weston, 1997; Akamatsu et al., 1999;Antic et al., 1999;Kasashima et al., 1999). While the exact function and targets of ELAV/Hu proteins remain to be fully elucidated, it seems likely that this family of RNA-binding proteins controls neuronal differentiation by selectively modulating the expression of neural-specific, growth-associated genes.The growth-associated protein GAP-43 is expressed in neurons primarily during the initial establishment and regeneration of neural connections (Skene, 1989;Benowitz and Routtenberg, 1997 Eggen et al., 1995;Chiaramello et al., 1996;Kinney et ...

show abstract

Cloning of Complementary DNA for GAP-43, a Neuronal Growth-Related Protein

Cited by 339 publications

References 27 publications

Regulation of Dendritic Branching and Filopodia Formation in Hippocampal Neurons by Specific Acylated Protein Motifs

Regulation of Dendritic Branching and Filopodia Formation in Hippocampal Neurons by Specific Acylated Protein Motifs

Involvement of Acidic Fibroblast Growth Factor in Spinal Cord Injury Repair Processes Revealed by a Proteomics Approach

The RNA-binding Protein HuD Is Required for GAP-43 mRNA Stability, GAP-43 Gene Expression, and PKC-dependent Neurite Outgrowth in PC12 Cells

Contact Info

Product

Resources

About