Cloning, sequencing, and molecular analysis of the groESL operon of Clostridium acetobutylicum

Narberhaus, Franz; Bahl, Hubert

doi:10.1128/jb.174.10.3282-3289.1992

Cited by 106 publications

(82 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The sequences presented in Fig. 3 demonstrate that these inverted repeat sequences are similar to those previously published for B. subtilis (9,19) and C. acetobutylicum (14). The inverted repeat can potentially form a hairpin-loop structure.…”

Section: Discussionsupporting

confidence: 67%

“…The same inverted repeat was also found, by sequence analysis, upstream of heat shock genes of several strains of Mycobacterium (see analysis of the data in reference 14), cyanobacteria (Synechococcus and Synechocystis spp. ), and Chlamydia psittaci (13,14,21). So far, the role of the inverted repeat at the transcription initiation site is not known, but it can conceivably form a hairpin-loop structure in RNA or DNA during transcription.…”

Section: Discussionmentioning

confidence: 99%

“…TTGACT<17>TATCTCGG---CTCTGCTGGCACTCCAACAAGGGGAGTGCTAACACCCATCACGGGG **** *** * ** * ****** * ********* * * B. TTGAAA<17>TATTATAAGAATTGTGTTAGCACTCTTTAGTGCTGAGTGCTAAAATTACATATTCAT **** * *** ***** ********** ********* * * C. TTGACA<17>TATCTCAAGAACCAGGTTAGCACTCGGACGAATAGAGTGCTAACAGCGGGCCATTCC *** * *** * * ********** * *********** Furthermore, these studies revealed the presence of a unique inverted repeat that coincides with transcription initiation (9,14,15,19,22). The same inverted repeat was also found, by sequence analysis, upstream of heat shock genes of several strains of Mycobacterium (see analysis of the data in reference 14), cyanobacteria (Synechococcus and Synechocystis spp.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Segal

Ron

1993

J Bacteriol

View full text Add to dashboard Cite

The groESL operon of Agrobacterium tumefaciens was cloned and sequenced and found to be highly homologous to previously analyzed groE operons in nucleotides of the coding region and in amino acid sequence. Transcription of this operon in A. tumefaciens was considerably stimulated by heat shock. Primer extension analysis revealed that the groE transcripts from cells under heat shock were initiated from the same promoter (a sigma-70-like promoter) as transcripts from untreated cells, and no sequence homology with the Escherichia coli heat shock promoters was observed. The DNA sequence downstream of the transcription start site contains an inverted repeat that has a strong similarity to other groESL operons of both gram-positive and gram-negative bacteria (such as cyanobacteria and chlamydiae). This conserved region is thought to form a hairpin-loop structure and may play a role in gene regulation during heat shock.The heat shock response is a widespread phenomenon that involves the induction of the synthesis of a large number of proteins following stress situations, such as a shift to higher temperatures. Several of these proteins are highly conserved, especially proteins encoded by dnaK (Hsp7O) and groEL (Hsp6O) (for reviews, see references 16, 17, and 25).In Escherichia coli, the heat shock response is mediated by a positive regulator protein sigma-32 (6). This sigma factor recognizes a promoter sequence different from that of the vegetative sigma factor (sigma-70) and in this way specifically transcribes heat shock genes (1, 3).Recently, it was observed that several gram-positive bacteria and several gram-negative bacteria (cyanobacteria and chlamydiae) contain an inverted repeat sequence that can form a hairpin-loop structure in the upstream regulatory region of genes coding for the heat shock proteins GroES and DnaK (9, 13-15, 19, 21, 22). In the gram-positive bacteria, it was clearly shown that transcription starts at the upstream end of this hairpin-loop structure and that the heat shock genes do not contain a sigma-32 promoter. It has been proposed that the hairpin-loop structures are involved in regulating the heat shock transcription of these genes.In this study, we present data on the groESL operon of Agrobacterium tumefaciens, a gram-negative purple bacterium, and show that it contains a hairpin-loop structure. This structure is similar to the one previously shown to be present in the upstream region of the heat shock genes of grampositive bacteria, cyanobacteria and chlamydiae. Moreover Preparation of chromosomal DNA. Cells from 10 LB agar plates were harvested by centrifugation (5,000 x g, 10 min, 40C) and washed once with 50 ml of TE (10 mM Tris-HCl [pH 8], 1 mM EDTA) buffer. The pellet was resuspended in 30 ml of 5% sucrose-50 mM Tris-HCl (pH 8)-50 mM EDTA and incubated for 15 min on ice, after the addition of 10 mg of lysozyme per ml. A 1/10 volume of 10% sodium dodecyl sulfate (SDS) was added, and the mixture was incubated for 15 min at 65°C. After two extractions with phenol-TE buffer and one ex...

show abstract

Section: Discussionsupporting

confidence: 67%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Segal

Ron

1993

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…For example, the dnaK operon was significantly induced at least 20 min after heat shock in C. botulinum, while in B. subtilis induction lasted for less than 10 min (26). Also Clostridium acetobutylicum, another Clostridium species lacking a B regulon, shows transient and, compared to B. subtilis, prolonged heat induction of the dnaK and groE operons (10,11). We thus suggest that the continued expression of class I HSGs may contribute to the greater ability of C. botulinum and C. acetobutylicum than B. subtilis to recover from heat shock (18).…”

Section: Discussionmentioning

confidence: 99%

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502

Selby

Lindström

Somervuo

et al. 2011

Appl Environ Microbiol

View full text Add to dashboard Cite

Class I heat shock genes (HSGs) code for molecular chaperones which play a major role in the bacterial response to sudden increases of environmental temperature by assisting protein folding. Quantitative reverse transcriptase real-time PCR gene expression analysis of the food-borne pathogen Clostridium botulinum grown at 37°C showed that the class I HSGs grpE, dnaK, dnaJ, groEL, and groES and their repressor, hrcA, were expressed at constant levels in the exponential and transitional growth phases, whereas strong downregulation of all six genes was observed during stationary phase. After heat shock from 37 to 45°C, all HSGs were transiently upregulated. A mutant with insertionally inactivated hrcA expressed higher levels of class I HSGs during exponential growth than the wild type, followed by upregulation of only groES and groES after heat shock. Inactivation of hrcA or of dnaK encoding a major chaperone resulted in lower maximum growth temperatures than for the wild type and reduced growth rates under optimal conditions compared to the wild type. The dnaK mutant showed growth inhibition under all tested temperature, pH, and NaCl stress conditions. In contrast, the growth of an hrcA mutant was unaffected by mild temperature or acid stress compared to the wild-type strain, indicating that induced class I HSGs support growth under moderately nonoptimal conditions. We show that the expression of class I HSGs plays a major role for survival and growth of C. botulinum under the stressful environmental conditions that may be encountered during food processing or growth in food products, in the mammalian intestine, or in wounds.

show abstract

“…The major heat-shock operons, groE and dnaK, are transcribed from vegetative promoters recognized by the primary factor, and are preceded by a highly conserved inverted repeat, consisting of 9 bp and separated by a 9-bp spacer (e.g. Narberhaus & Bahl 1992;Zuber & Schumann 1994). This inverted repeat 'CIRCE' (con-trolling inverted repeat for chaperone expression) was recently shown to represent a site for binding a putative repressor encoded by a member of the B. subtilis dnaK operon (Yuan & Wong 1995), consistent with the early genetic data (Zuber & Schumann 1994).…”

Section: Conservation Ofmentioning

confidence: 99%

Regulation and conservation of the heat‐shock transcription factor σ³²

Yura

1996

Genes to Cells

View full text Add to dashboard Cite

Heat shock and other stresses induce a set of genes encoding molecular chaperones and proteases through increase in the level of transcription factor 32 in Escherichia coli. Some of the cis-and transacting factors involved in the control of synthesis (translation), degradation and activity of 32 have been identified and characterized. These studies contribute to our understanding of early events of the heat-shock response, including modes of interaction between chaperones and 32 . Besides, analysis of 32 homologues from diverse bacteria reveals new insights into evolution of the regulatory mechanisms.

show abstract

Cloning, sequencing, and molecular analysis of the groESL operon of Clostridium acetobutylicum

Cited by 106 publications

References 51 publications

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502

Regulation and conservation of the heat‐shock transcription factor σ³²

Contact Info

Product

Resources

About

Cloning, sequencing, and molecular analysis of the groESL operon of Clostridium acetobutylicum

Cited by 106 publications

References 51 publications

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502

Regulation and conservation of the heat‐shock transcription factor σ32

Contact Info

Product

Resources

About

Regulation and conservation of the heat‐shock transcription factor σ³²