Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

Abstract

RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition.

RNA regulators responding to ribosomal protein S15 are frequent in sequence space

“…Because there is no regulatory interaction between the mRNA regulator from E. coli (Ec-mRNA) and Gk-S15 (37), and the Ec-mRNA allows robust expression in E. coli , the randomized RNA pool was based upon Ec-mRNA sequence: 5′- TGCGTAACGTACACT -N 30 - TCATTCTATATACTTT GGAG TTTTAA A ATG TCTCTAAGTACTGAAGCAACAGCT , where primer binding regions are underlined, and N 30 denotes a randomized region of 30 nucleotides (Supplementary Figure S1B). The native E. coli rpsO start codon is retained in the 3′ primer region (bolded), and the native Shine-Dalgarno sequence is not within the randomized region (bolded).…”

“…One plasmid contains an RNA- lacZ reporter with a selected RNA sequence cloned upstream and in-frame with lacZ and under the control of an IPTG-inducible pLac promoter. A second plasmid carries the G. kaustophilus rpsO coding sequence under the control of an L-arabinose-inducible promoter (37). The plasmids are co-transformed into an E. coli K12:Δ rpsO strain (44).…”

“…LacZ regulatory assays: As described previously (37), K12: Δ rpsO E. coli cells were co-transformed with pRNA and pS15 plasmid (made competent using the Z-competent buffer system, Zymo Research). A single colony was used to start overnight cultures, grown ± L-arabinose (15 mM) at 37°C, 225 rpm, then diluted the next day to OD600 = 0.15 in fresh media (LB + 100 µg/ml ampicillin + 34 µg/ml chloramphenicol ± 15 mM L-arabinose).…”

“…In addition to its primary function within the ribosome, in different bacterial species ribosomal protein S15 interacts with at least four different mRNA regulators to control its own translation (23,25,26,35). Our previous work and that of others indicated that G. kaustophilus S15 (Gk-S15) does not interact with the mRNA regulator originating from E. coli (Ec-mRNA) (36,37), and the thermophillic nature of G. kaustophilus makes the protein easy to handle and purify. Therefore, we used the E. coli mRNA regulatory sequence as the basis for a randomized RNA pool and conducted in vitro selection to identify sequences that interact with Gk-S15.…”

“…From this work, we conclude that RNA regulators responding to S15 are common within sequence space. Thus, the diversity of S15 regulatory RNAs is driven not only by co-evolution with the protein partners (37), but also by the relatively high frequency of such regulators appearing in sequence space.…”