Coexistence of an ILPR i-Motif and a Partially Folded Structure with Comparable Mechanical Stability Revealed at the Single-Molecule Level

Abstract

Investigation of i-motif is of high importance to fully understand the biological functions of G quadruplexes in the context of double stranded DNA. Whereas single molecule approaches have profiled G quadruplexes from a perspective unavailable by bulk techniques, there is a lack of similar literature on the i-motif in the cytosine (C) rich region complementary to G quadruplex forming sequences. Here, we have used laser tweezers to investigate the structures formed in 5′-(TGTCCCCACACCCC)2, a predominate variant in the insulin linked polymorphic region (ILPR). We have observed two species with the change in contour length (ΔL) of 10.4 (±0.1) and 5.1 (±0.5) nm, respectively. Since ΔL of 10.4 nm is located within the expected range for an i-motif structure, we assign this species to the i-motif. The formation of the i-motif in the same sequence has been corroborated by bulk experiments such as Br2 footprinting, circular dichroism, and thermal denaturation. The assignment of the i-motif is further confirmed by decreased formation of this structure (23 % to 1.3 %) with pH 5.5 7.0, which is a well established behavior for i-motifs. In contrast to the i-motif, the formation of the second species with ΔL of 5.1 nm remains unchanged (6.1±1.6 %) in the same pH range, implying that pH sensitive C:CH+ pairs may not contribute to the structure as significantly as those to the i-motif. Compared to the ΔGunfold of i-motif (16.0 ±0.8 kcal/mol), the decreased free energy in the partially folded structure (ΔGunfold 10.4 ± 0.7 kcal/mol) may reflect a weakened structure with reduced C:CH+ pairs. Both ΔL and ΔGunfold argue for the intermediate nature of the partially folded structure in comparison to the i-motif. In line with this argument, we have directly observed the unfolding of i-motif through the partially folded structure. The i-motif and the partially folded structure share similar rupture forces of 22-26 pN, which are higher than those that can stall transcription catalyzed by RNA polymerases. This suggests, from a mechanical perspective alone, that either of the structures can stop RNA transcription.

Single-Molecule Measurements of the Binding between Small Molecules and DNA Aptamers

“…The change in contour length (ΔL; see the Materials and Methods for the calculation) was determined to be 9.2 ± 0.1 nm, a value consistent with the contour length of the 27-mer ATP aptamer. 30,35 In a control with a scramble sequence (see the Materials and Methods) that does not assume any stable conformations, no folded structure was observed (data not shown), which strongly suggests that the observed events are due to the ruptures of folded ATP aptamers. The unfolding force at which the rupture event occurred showed a most probable value of 21 pN without the ATP ligand (Figure 2A).…”

A Pharmacological Chaperone Molecule Induces Cancer Cell Death by Restoring Tertiary DNA Structures in Mutant hTERT Promoters

“…GGGGGCTGGGCCGGAAACCCGGGAGGGGTCGGGACGGGGCGGGGC and 5′-GCCCCGCCCCGTCCCGACCCCTCCCGGGTTTCCGGCCCAGCCCCC; mutated bases are underlined) between two double-stranded DNA handles, according to published procedures. 54 Five deoxythymidines were added at both ends of the hTERT 5-12 fragment to reduce the interference from the double-stranded DNA handles on the target sequence. Briefly, the 2690-base-pair double-stranded DNA handle was prepared through restriction enzyme digestion of the pEGFP vector (Clontech, Mountain View, CA).…”

“…where x is the end-to-end distance for G-quadruplex or i-motif structures (0.5-1.5 nm) 54 and subjected to dual-luciferase assay (Promega) using an FB12 luminometer. The ratio of firefly to renilla luciferase activity was normalized to the DMSO to obtain the relative luciferase activity.…”

The interactions of phenanthroline compounds with DNAs: Preferential binding to telomeric quadruplex over duplex

“…The specific binding of i-motif-forming sequences to various proteins implies the potential biological function of i-motifs that may form in these sequences. More recently, Mao and co-workers have indicated that i-motif structure may interfere with RNA transcription [21]. But until now a few of small molecules that interact with i-motif DNA have been reported [22,23].…”