Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris

Abstract

The methylotrophic yeast Pichia pastoris (Komagataella phaffii) is one of the most commonly used expression systems for heterologous protein production. However the recombination machinery in P. pastoris is less effective in contrast to Saccharomyces cerevisiae, where efficient homologous recombination naturally facilitates genetic modifications. The lack of simple and efficient methods for gene disruption and specifically integrating cassettes has remained a bottleneck for strain engineering in P. pastoris. Therefore tools and methods for targeted genome modifications are of great interest. Here we report the establishment of CRISPR/Cas9 technologies for P. pastoris and demonstrate targeting efficiencies approaching 100%. However there appeared to be a narrow window of optimal conditions required for efficient CRISPR/Cas9 function for this host. We systematically tested combinations of various codon optimized DNA sequences of CAS9, different gRNA sequences, RNA Polymerase III and RNA Polymerase II promoters in combination with ribozymes for the expression of the gRNAs and RNA Polymerase II promoters for the expression of CAS9. Only 6 out of 95 constructs were functional for efficient genome editing. We used this optimized CRISPR/Cas9 system for gene disruption studies, to introduce multiplexed gene deletions and to test the targeted integration of homologous DNA cassettes. This system allows rapid, marker-less genome engineering in P. pastoris enabling unprecedented strain and metabolic engineering applications.

Effect of Plasmid Design and Type of Integration Event on Recombinant Protein Expression in Pichia pastoris

“…We chose GUT1, as it was reported to be well suited for HTP screening (12). Notably, we obtained higher specific integration rates in the GUT1 locus by homologous recombination than those reported in previous studies (12), despite using identical 5= and 3= homologous regions and expression cassettes based on a similar vector family.…”

“…We chose GUT1, as it was reported to be well suited for HTP screening (12). Notably, we obtained higher specific integration rates in the GUT1 locus by homologous recombination than those reported in previous studies (12), despite using identical 5= and 3= homologous regions and expression cassettes based on a similar vector family. Although hard to rationalize, this difference may be related to the insertion of longer sequences (P AOX1 , eGFP, and terminator expression cassette) between the GUT1 5= and 3= regions in our study, as the previous knockout cassette contained only a resistance marker (12,31).…”

“…This plasmid is referred to as the standard (STD) vector in this study. For the GUT1 integration vector (GUT1), GUT1 5= and 3= homologous sequences reported by Weninger et al (12) were cloned into the STD vector, which was first linearized with SwaI. The 5= GUT1 region was amplified using the primers GUT1-3prime-GUT1-5prime-Gib (5=-CACGATACGAACGTTGTTTCCTCTTATATTTAAATCTAGGTCATCCTACAGC AAACACC-3=) and GUT1-5prime-pAOX1-Gib (5=-GTTTCATTCAACCTTTCGTCTTTGGATGTTTATAGTAGA TATATCTGTGGTATAGTGTGAAAAAGTAGAAG-3=).…”

“…2 and 3) were performed as outlined previously (13,28,30). Correct integration in the GUT1 locus (leading to glycerol auxotrophy) was performed as outlined previously (12). Notably, we did not stamp the cells on glycerol-or glucose-containing plates but rather inoculated them in liquid media in deep-well plates containing buffered minimal media (BM; 1.34% yeast nitrogen base, 4 ϫ 10 Ϫ5 % biotin, 200 mM potassium phosphate buffer [pH 6.0], and either 1% glucose [in the form of dextrose; BMD] or 1% glycerol [BMG]) as the carbon source.…”

“…In S. cerevisiae, short overhangs of ϳ50 bp flanking the expression cassettes are sufficient to achieve close to 100% correct integration. In contrast, in P. pastoris even ϳ1-kb-long overhangs may result in only Ͻ1 to 30% specific integration (11,12). Hence, it appears that nonhomologous end joining (NHEJ) resulting in ectopic, nonspecific integration plays a stronger role in P. pastoris than in S. cerevisiae (where homologous recombination [HR] occurs nearly exclusively).…”