Combining Data in Phylogenetic Systematics: An Empirical Approach Using Three Molecular Data Sets in the Solanaceae

Olmstead, Richard G.; Sweere, Jennifer A.

doi:10.1093/sysbio/43.4.467

Cited by 553 publications

(140 citation statements)

References 27 publications

Supporting

Mentioning

137

Contrasting

Order By: Relevance

“…We used the following primers: ndhF5 (5′ ATGGAACATACATATCAATATTCATGG 3′) and ndhF2100 (5′CAAAGAAACTYGTAAKACSTACT CC 3′) (Olmstead & Sweere, 1994) to amplify ndhF; tabA (5′ CATTACAAATGCGATGCTCT 3′) and tabD (5′ GGGGATAGAGGGACTTGAAC 3′) (Taberlet & al., 1991) for trnT-L; ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′), ITS2 (5′ GCTGCGTTCTTCATCGATGC 3′), ITS3 (5′ GCATCGATGAAGAACGCAGC 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) primers for the ITS1-5.8s-ITS2 region (White & al., 1990). PCR reactions were performed in a total volume of 50 µL, with the following composition: 5 μL 10× buffer containing MgCl 2 at 1.5 mmol/L (New England BioLabs), 0.1 mmol/L each dNTP, 0.2 µmol/L each primer and 0.02 U Taq DNA polymerase (New England Biolabs).…”

Section: Phylogenetic Analysismentioning

confidence: 99%

“…Reactions for ndhF PCR products were mixed with 0.15 volume of 3 M sodium acetate, pH 4.6 and 3 volumes 95% (v/v) ethanol and subsequently purified by centrifuging at 4°C. Amplicons were then sent to Macrogen (Geumchun-gu, Seoul, Korea; http://www.macrogen.com) to be sequenced, using the respective PCR primers and additional internal primers for ndhF (ndhF599: 5′ TAGGTCTTTATTGGATAAC 3′; ndhF989-R: 5′ TGATGTTAGCTCTAGGATGTATGGG 3′; and ndhF1354: 5′ AAATGTCCTTCAAAAGTAAG 3′; Olmstead and Sweere, 1994) as well as for trnT-L regions (tabB: 5′TCTACCGATTTCGCCATATC 3′; and tabC: 5′ CGAAATCGGTAGACGCTACG 3′; Taberlet & al., 1991).…”

Section: Phylogenetic Analysismentioning

confidence: 99%

See 1 more Smart Citation

Phylogenetic relationships of Erysimum (Brassicaceae) from the Baetic Mountains (SE Iberian Peninsula)

Abdelaziz¹,

Muñoz-Pajares²,

Lorite³

et al. 2014

Anal. Jard. Bot. Madr.

View full text Add to dashboard Cite

The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L) and one nuclear DNA region (ITS1-5.8S rDNA-ITS2), with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait. Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se ha diversificado profusamente en la región mediterránea, con más de un centenar de especies descritas en dicha área, del total de las alrededor de 200 especies incluidas en el género. Usamos dos regiones de ADN plastidial (ndhF y trnT-L) y una región de ADN nuclear (ITS1-5.8S rDNA-ITS2), con una longitud total de 3.556 pb, para llevar a cabo análisis filogenéticos mediante inferencia bayesiana, máxima verosimilitud y máxima parsimonia, con el fin de explorar las relaciones evolutivas entre las especies de Erysimum que habitan en éstas cordilleras. El análisis de secuencias concatenadas de los dos genomas identifica dos clados principales y las muestras de la misma especie aparecen siempre en un clado o en el otro pero no en ambos. Las relaciones filogenéticas que indican esos dos clados no apoyan la circunscripción del grupo taxonómico E. nevadense, previamente definido en dicho género. Además, los análisis indican cambios recurrentes en el color floral de las especies de Erysimum que habitan los Sistemas Béticos aunque la evolución reticulada, que sugiere la posición de algunos ...

show abstract

Section: Phylogenetic Analysismentioning

confidence: 99%

Section: Phylogenetic Analysismentioning

confidence: 99%

Phylogenetic relationships of Erysimum (Brassicaceae) from the Baetic Mountains (SE Iberian Peninsula)

Abdelaziz¹,

Muñoz-Pajares²,

Lorite³

et al. 2014

Anal. Jard. Bot. Madr.

View full text Add to dashboard Cite

show abstract

“…We used the primers 972F and 2110R described by Olmstead & Sweere (1994) to amplify the 3' half of ndhF. The PCR reactions included 25 µl total (2.5 µl 10X buffer, 5.0 µ l Q solution (Qiagen), 1.0 µl MgCl 2 (25mM), 1.0 µ l dNTPs (25mM), 1 µl each for the F and R primers (10mM), 0.2 µl Taq polymerase, 1.0 ul DNA template, and 11.3 ul of ddH20), with the following conditions: denaturation at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 45 s, annealing at 49°C for 90 s, and extension at 72°C for 3 min, with a final extension step at 72°C for 7 min.…”

Section: Phylogenetic Analysis Based On Molecular Datamentioning

confidence: 99%

Systematics of Mappia (Icacinaceae), an endemic genus of tropical America

Angulo¹,

Stéfano²,

Stull³

2013

Phytotaxa

View full text Add to dashboard Cite

Mappia includes four species of trees and shrubs distributed in Central America, Mexico and the Greater Antilles. Mappia has historically been associated with the genera Casimirella (=Humirianthera), Icacina, Leretia and Nothapodytes, collectively comprising the Mappia complex, and over the years authors have merged or maintained these genera based on various lines of morphological and anatomical evidence. Here we present a phylogenetic study of the Mappia complex, based on morphological and molecular data, to assess monophyly of Mappia as well as relationships among other icacinaceous genera. Our results indicate that Mappia is sister to the Asiatic genus Nothapodytes, consistent with previous studies, and that Leretia, Icacina and Casimirella form a clade more closely related to other genera of Icacinaceae (e.g., Alsodeiopsis, Iodes, Phytocrene) than to Mappia+Nothapodytes. These results support recognition of Mappia as a distinct entity, and here we provide an updated taxonomic treatment for the genus, recognizing four species including three from Mexico and Central America (M. longipes, M. mexicana, and M. multiflora) and one from the Greater Antilles (M. racemosa).

show abstract

“…For example, a comparison between Cladosporium, Penicillium and Fusarium species at the NCBI Genome and GenBank databases (Schoch et al, 2012) will confirm this statement. Such considerations suggested that phylogenetic trees based on sets of genes are potentially more powerful in solving species boundaries than phylogenetic trees based on any single genes, as the former trees contain information about the simultaneous evolution of various biological processes (Olmstead & Sweere, 1994; Rokas et al, 2003). …”

Section: Introductionmentioning

confidence: 99%

Evaluating multi-locus phylogenies for species boundaries determination in the genusDiaporthe

Santos

Alves

2017

PeerJ

View full text Add to dashboard Cite

BackgroundSpecies identification is essential for controlling disease, understanding epidemiology, and to guide the implementation of phytosanitary measures against fungi from the genus Diaporthe. Accurate Diaporthe species separation requires using multi-loci phylogenies. However, defining the optimal set of loci that can be used for species identification is still an open problem.MethodsHere we addressed that problem by identifying five loci that have been sequenced in 142 Diaporthe isolates representing 96 species: TEF1, TUB, CAL, HIS and ITS. We then used every possible combination of those loci to build, analyse, and compare phylogenetic trees.ResultsAs expected, species separation is better when all five loci are simultaneously used to build the phylogeny of the isolates. However, removing the ITS locus has little effect on reconstructed phylogenies, identifying the TEF1-TUB-CAL-HIS 4-loci tree as almost equivalent to the 5-loci tree. We further identify the best 3-loci, 2-loci, and 1-locus trees that should be used for species separation in the genus.DiscussionOur results question the current use of the ITS locus for DNA barcoding in the genus Diaporthe and suggest that TEF1 might be a better choice if one locus barcoding needs to be done.

show abstract

Combining Data in Phylogenetic Systematics: An Empirical Approach Using Three Molecular Data Sets in the Solanaceae

Cited by 553 publications

References 27 publications

Phylogenetic relationships of <em>Erysimum</em> (Brassicaceae) from the Baetic Mountains (SE Iberian Peninsula)

Phylogenetic relationships of <em>Erysimum</em> (Brassicaceae) from the Baetic Mountains (SE Iberian Peninsula)

<p class="Default">Systematics of Mappia (Icacinaceae), an endemic genus of tropical America

Evaluating multi-locus phylogenies for species boundaries determination in the genusDiaporthe

Contact Info

Product

Resources

About