Comparative analysis of HPV16 gene expression profiles in cervical and in oropharyngeal squamous cell carcinoma

Cerasuolo, Andrea; Annunziata, Clorinda; Tortora, Marianna; Starita, Noemy; Stellato, G; Greggi, Stefano; Maglione, Maria Grazia; Ionna, Franco; Losito, Simona; Botti, Gerardo; Buonaguro, Luigi; Tornesello, Maria Lina

doi:10.18632/oncotarget.15977

Cited by 25 publications

(32 citation statements)

References 80 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was extracted from approximately 10 mg of fresh frozen tissues and 5 × 10 6 cultured cells by digestion with proteinase K (150 μg per mL at 37°C for 10 hr) in 100 μL of lysis buffer (10 mM Tris–HCl pH 7.6, 5 mM EDTA, 150 mM NaCl, 1% SDS), followed by extraction with phenol–chloroform–isoamyl alcohol (25:24:1) and ethanol precipitation in 0.3 M sodium acetate (pH 4.6) . DNA was extracted from paraffin embedded tissues as described previously .…”

Section: Methodsmentioning

confidence: 99%

“…TERT expression levels were evaluated by real‐time PCR using forward (5′‐CGGAAGAGTGTCTGGAGCAA‐3′) and reverse (5′‐GGATGAAGCGGAGTCTGGA‐3′) primers targeting TERT exon 3 and exon 4, respectively, which encompassing the intron 3 allow to exclude cross contamination of cDNA with genomic DNA. The samples have been analyzed previously for HPV16 early (E2/E4, E5, E6, E6*I, E6*II, E7) and late (L1 and L2) transcripts by real‐time PCR . The reaction mixtures included 12.5 μL of 1× iQ SYBR Green supermix (Bio‐Rad Laboratories Inc., Hercules, CA), 10 pmol of each primer, 1 μL of cDNA and nuclease‐free water in a final volume of 25 μL.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma

Annunziata

Pezzuto

Greggi

et al. 2018

Intl Journal of Cancer

Self Cite

View full text Add to dashboard Cite

Two recurrent mutations (-124 G > A and -146 G > A) in the core promoter region of the human telomerase reverse transcriptase (TERT) gene create consensus binding sites for ETS transcription factors and cause increased TERT expression in several tumour types. We analyzed TERT promoter mutations and TERT mRNA levels in head and neck cancer, cervical carcinoma and cervical intraepithelial neoplasia (CIN) as well as in C-4I, CaSki, HeLa and SiHa cervical cell lines. Nucleotide sequence analysis of TERT promoter region showed that 33.3% of oral squamous cell carcinoma (SCC) and 16.8% of cervical SCC harboured mutually exclusive G to A transitions at nucleotide position -124 or -146. TERT promoter was mutated at nucleotide -146 (G > A) in SiHa cell line. Other nucleotide changes creating in some cases putative ETS binding sites were more frequent in oral SCC (26.7%) than in cervical carcinoma (4.8%). The frequency of mutations was independent of human papillomavirus (HPV) tumour status in both cervical and oral cancer. Expression of TERT gene was significantly higher in TERT promoter mutated (-124G > A or -146G > A) cervical SCC compared to not mutated SCC irrespective of HPV16 E6 and E7 levels. Such hot spot changes were not detected in oropharyngeal SCC, cervical adenocarcinoma and CIN lesions. Our results suggest that TERT promoter mutations play a relevant role in oral SCC as well as in cervical SCC, besides the already known effect of HPV16 E6 protein on TERT expression.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma

Annunziata

Pezzuto

Greggi

et al. 2018

Intl Journal of Cancer

Self Cite

View full text Add to dashboard Cite

show abstract

“…This result may reflect the higher proliferation rate of HPV-infected cells from COMC compared to CSOM and NME, suggesting that viral DNA replication may occur in COMC. It has been reported that HPV infection leads to the expression of the viral oncoproteins E6 and E7, which stimulate cell growth and viral DNA replication [22,[33][34][35][36][37]. Although no studies are available on HPV DNA load in normal and pathological middle ear tissues, our results are in agreement with previous uterine cervix investigations reporting a mean of viral DNA copy/cell ranging from 0.1 to 18 in cervical intraepithelial neoplasia and less than one viral DNA copy/cell in normal cervical tissues [37,38].…”

Section: Discussionmentioning

confidence: 99%

High Human Papillomavirus DNA loads in Inflammatory Middle Ear Diseases

et al. 2020

View full text Add to dashboard Cite

Background. Previous studies reported human papillomaviruses (HPVs) in middle ear tumors, whereas these viruses have been poorly investigated in chronic inflammatory middle ear diseases. We investigated HPVs in non-tumor middle ear diseases, including chronic otitis media (COM). Methods. COM specimens (n = 52), including chronic suppurative otitis media (CSOM) (n =38) and cholesteatoma (COMC) (n = 14), as well as normal middle ear (NME) specimens (n = 56) were analyzed. HPV sequences and DNA loads were analyzed by quantitative-PCR. HPV genotyping was performed by direct sequencing. Results. HPV DNA was detected in 23% (12/52) of COM and in 30.4% (17/56) of NME (p > 0.05). Specifically, HPV DNA sequences were found in 26.3% (10/38) of CSOM and in 14.3% (2/14) of COMC (p > 0.05). Interestingly, the HPV DNA load was higher in COMC (mean 7.47 copy/cell) than in CSOM (mean 1.02 copy/cell) and NME (mean 1.18 copy/cell) (P = 0.03 and P = 0.017 versus CSOM and NME, respectively). HPV16 and HPV18 were the main genotypes detected in COMC, CSOM and NME. Conclusions. These data suggest that HPV may infect the middle ear mucosa, whereas HPV-positive COMCs are associated with higher viral DNA loads as compared to NME.Pathogens 2020, 9, 224 2 of 10 mucosa sampled from CSOM patients [11]. However, the etiology of CSOM remains to be determined. The relationship between HPV infection and inflammation has been previously reported [12]. It has been shown that persistent infection with high-risk HPVs leads to an increase in pro-inflammatory cytokines, including IL-6, TNF-α and MIP-1α [13]. In addition, high-risk HPV type 16 (HPV16) is able to increase the expression of cyclooxygenase-2 (COX-2), a key enzyme in the synthesis of prostaglandins, which are important mediators of inflammation [14,15]. Until now, only a single study has reported HPV DNA sequences in CSOM, whereby different HPV genotypes, including HPV16, HPV18 and HPV6, have been detected in 30.7% of CSOM [4].COMC is a form of expanding growth consisting of keratinizing squamous cell epithelium [16]. There is great interest in the etiopathogenesis of HPV-associated cholesteatoma because HPV commonly infects the stratified epithelium [17,18]. However, conflicting data have been reported for HPV in COMC [10,[19][20][21]. HPV sequences have been detected in COMC with different prevalence, ranging from 3% to 70% [10,[19][20][21]. Moreover, no specific HPV genotypes have been associated with COMC, as high-and low-risk HPVs, such as HPV16, HPV18 and HPV6 and HPV11, have been detected [10,[19][20][21].There is emerging evidence that HPV infection can occur in different anatomical sites. Since HPV infects epithelia [22], all anatomical sites covered with epithelial tissue are potentially exposed to HPV infection. Apart from pluristratified tissues of the cervix [23], vulva [24] and oral pharynx [25], HPV sequences have been detected in simple epithelia from several anatomical sites such as lung [26], upper respiratory tract [27], larynx [28] and nose [29]. Since the middle ear muc...

show abstract

“…In terms of risk factors, pathogenesis as well as in prognosis, OPSCC can be subdivided into two groups: HPV‐positive and HPV‐negative tumours. Particularly, the high‐grade HPV type 16 was shown to induce cancers of the cervix and head and neck region—especially OPSCC . HPV‐negative OPSCC are frequently associated with consumption of tobacco and alcohol, cause less lymphatic metastasis, and were shown to have a worse prognosis in comparison with HPV‐positive OPSCC .…”

Section: Discussionmentioning

confidence: 99%

“…Particularly, LNR incorporates the information of extension of neck dissection as well as the number of positive lymph node metastases, which is not included in the UICC/ AJCC TNM classification concept in detail.In terms of risk factors, pathogenesis as well as in prognosis, OPSCC can be subdivided into two groups: HPV-positive and HPV-negative tumours. Particularly, the high-grade HPV type 16 was shown to induce cancers of the cervix and head and neck region-especially OPSCC 2,[17][18][19]. HPV-negative OPSCC are frequently associated with consumption of tobacco and alcohol, cause less lymphatic metastasis,…”

mentioning

confidence: 99%

The relevance of the lymph node ratio as predictor of prognosis is higher in HPV‐negative than in HPV‐positive oropharyngeal squamous cell carcinoma

Meyer

Meinrath

Seehawer

et al. 2017

Clinical Otolaryngology

View full text Add to dashboard Cite

show abstract

Comparative analysis of HPV16 gene expression profiles in cervical and in oropharyngeal squamous cell carcinoma

Cited by 25 publications

References 80 publications

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma

High Human Papillomavirus DNA loads in Inflammatory Middle Ear Diseases

The relevance of the lymph node ratio as predictor of prognosis is higher in HPV‐negative than in HPV‐positive oropharyngeal squamous cell carcinoma

Contact Info

Product

Resources

About