Comparative Analysis of Rhizospheric Fungi Using High-Throughput Sequencing between Wild, Ex Situ, and Reintroduced Pinus squamata, a Plant Species with Extremely Small Populations in Yunnan Province, China

Abstract

Pinus squamata is a rare and endangered tree endemic to northeastern Yunnan Province, China, and it is listed as a Plant Species with Extremely Small Populations (PSESP) in China for requiring urgent conservation. Furthermore, the actions of ex situ conservation and reintroduction based on artificial propagation have been carried out since some 15 years ago. The rhizosphere microbiome plays an important role in soil quality and plant health. However, how the fungal communities of the rhizosphere differ between wild, ex situ, and reintroduced examples of Pinus squamata remains unclear. Illumina sequencing of the internal transcribed spacer 2 (ITS2) region was used to investigate fungal communities in the P. squamata rhizosphere soil. Rhizospheric fungal community composition, structure, diversity, and ecological function in the soil surrounding wild, ex situ, and reintroduced P. squamata individuals were elucidated. The ex situ site Kunming (EK) had the highest fungal community richness and diversity. The samples collected from six different sites were well separated (R = 0.95, p = 0.001), suggesting significant differences between the sites. Soil total potassium (TK), available phosphorus (AP), and pH were the main factors driving fungal community (0.01 < p ≤ 0.05). Prediction of fungal functional guild in the P. squamata rhizosphere demonstrated that the fungi could be classified as ectomycorrhizal, endophyte, and plant pathogenic fungi. Our research will provide a basis to guide the further selection of conservation sites for P. squamata based on fungal diversity and offer guidance on the antagonistic fungi and plant pathogenic fungi that may be of relevance to the conservation of this rare plant.

Comparison of Rhizosphere Bacterial Communities of Pinus squamata, a Plant Species with Extremely Small Populations (PSESP) in Different Conservation Sites

“…The samples from the reintroduced population were taken from a site in Qiaojia County (RQ). Locations are detailed in reference [27]. Each site collected samples from three individuals.…”

“…National standards of the People's Republic of China were used to determine the soil physicochemical parameters [29]: soil pH, soil organic matter (OM), soil total nitrogen (TN), soil total phosphorus (TP), soil total potassium (TK), soil available nitrogen (AN), soil available potassium (AK), and soil available phosphorus (AP) were tested. Specific methods are described in reference [27].…”

“…The V3-V4 region of the 16S rRNA genes was amplified using the bacterial universal primer pairs 338F (ACTCCTACGGGAGGCAGCAG)_806R (GGACTACHVGGGTWTCTAAT) [30]. PCR amplification and the reaction mixture are detailed in reference [27]. Thermal cycling conditions comprised a 3 min denaturing step at 95 • C, followed by 27 cycles of 30 s at 95 • C, 30 s of annealing at 55 • C, and 45 s at 72 • C. A final extension was performed at 72 • C for 10 min, followed by 10 • C until halted.…”

“…Thermal cycling conditions comprised a 3 min denaturing step at 95 • C, followed by 27 cycles of 30 s at 95 • C, 30 s of annealing at 55 • C, and 45 s at 72 • C. A final extension was performed at 72 • C for 10 min, followed by 10 • C until halted. High-throughput sequencing using Illumina MiSeq PE300 (Illumina, San Diego, CA, USA) is detailed in reference [27]. The National Microbiology Data Center (NMDC, https://nmdc.cn/) facilitates effective organization, integration, and transparent sharing of a considerable amount of microbiological data [31].…”

“…Therefore, the integrated study of soil properties and rhizosphere bacteria can assist conservation, as it allows us to understand the conditions required for conservation of rare and endangered species. A comparative analysis of rhizospheric fungi between wild, ex situ, and reintroduced P. squamata was researched by Li and Sun [27]. To date, little is known about the rhizospheric bacterial communities found in the soil of P. squamata.…”