Comparative proteome analysis in an Escherichia coli CyDisCo strain identifies stress responses related to protein production, oxidative stress and accumulation of misfolded protein

Abstract

BackgroundThe Twin-arginine translocation (Tat) pathway of Escherichia coli has great potential for the export of biopharmaceuticals to the periplasm due to its ability to transport folded proteins, and its proofreading mechanism that allows correctly folded proteins to translocate. Coupling the Tat-dependent protein secretion with the formation of disulfide bonds in the cytoplasm of E. coli CyDisCo provides a powerful platform for the production of industrially challenging proteins. In this study, we investigated the effects on the E. coli cells of exporting a folded substrate (scFv) to the periplasm using a Tat signal peptide, and the effects of expressing an export-incompetent misfolded variant.ResultsCell growth is decreased when either the correctly folded or misfolded scFv is expressed with a Tat signal peptide. However, only the production of misfolded scFv leads to cell aggregation and formation of inclusion bodies. The comprehensive proteomic analysis revealed that both conditions, recombinant protein overexpression and misfolded protein accumulation, lead to downregulation of membrane transporters responsible for protein folding and insertion into the membrane while upregulating the production of chaperones and proteases involved in removing aggregates. These conditions also differentially affect the production of transcription factors and proteins involved in DNA replication. The most distinct stress response observed was the cell aggregation caused by elevated levels of antigen 43. Finally, Tat-dependent secretion causes an increase in tatA expression only after induction of protein expression, while the subsequent post-induction analysis revealed lower tatA and tatB expression levels, which correlate with lowered TatA and TatB protein abundance.ConclusionsThe study identified characteristic changes occurring as a result of the production of both a folded and a misfolded protein, but also highlights an exclusive unfolded stress response. Countering and compensating for these changes may result in higher yields of pharmaceutically relevant proteins exported to the periplasm.Electronic supplementary materialThe online version of this article (10.1186/s12934-019-1071-7) contains supplementary material, which is available to authorized users.

Cryo-EM Structure of Bacterioferritin Nanocages Provides Insight into the Bio-mineralization of Ferritins

“…Consistently, others (Bradley et al, 2016, Crabb, Moore et al, 2010, Theil, Tosha et al, 2016) have suggested that the chemical content and structure of iron inside the core is polyphasic or heterogenous and may not be packed regularly. Moreover, the enhanced deposition of Fe-biomineral inside the cavity is presumably due to protein overexpression in the recombinant bacteria, and that this stressful environment facilitates the active conversion of Fe 2+ to Fe 3+ (Guerrero Montero, Dolata et al, 2019).…”

Escherichia coli “TatExpress” strains export several g/L human growth hormone to the periplasm by the Tat pathway

“…pKRK38 was made by polymerase chain reaction (PCR) amplification using pKRK7 as a template and primers Mature_hGH_F (5′‐ATGTTCCCAACCATTCCCTTATCCA‐3′) and Mature_hGH_R (5′‐CATACATGTTCCTCTGTGGTAGGGT‐3′) as forward and reverse primers. PCR solutions, enzymes and reaction conditions were as described in Guerrero‐Montero et al ().…”

“…Protein samples were resolved by reducing sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) and analyzed using Coomassie blue staining and western blotting. All immunoblotting procedures were as described in Guerrero‐Montero et al (). Periplasmic hGH activity was assayed using an hGH bioassay (PathHunter® Human Growth Hormone Bioassay Kit, Sigma) using the manufacturer's protocol.…”

Escherichia coli Can Adapt Its Protein Translocation Machinery for Enhanced Periplasmic Recombinant Protein Production

“…Protein digestion, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis, protein identification and quantification methodology used to analyze the proteome of cells producing periplasmic hGH using different signal peptides and control cells with an empty expression vector have been described in detail previously (Guerrero Montero et al, 2019). In short, proteins in whole cell lysates were separated by SDS-PAGE and subsequently each lane was cut into 10 equidistant pieces prior to in-gel digestion using trypsin.…”

“…The generated peptides were eluted from the gel to an aqueous solution by ultrasonication and the concentrated peptide mixture was subjected to LC-MS/MS analysis performed on an EASY-nLC II coupled to an LTQ Orbitrap (Thermo Fisher Scientific) mass spectrometer. Peptides were separated on in-house self-packed columns (Guerrero Montero et al, 2019) FIGURE 1 | Periplasmic hGH production screening and proteome analysis of hGH producing cells. (A) On the left: Periplasmic production screening of hGH fused to different signal peptides (DsbA sp , Hbp sp , OmpA sp , and PhoA sp ) was done in standard 24-well plates (i).…”